Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

TUBA1B cdna clone

TUBA1B cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
TUBA1B; K-ALPHA-1
Synonyms
TUBA1B; N/A; TUBA1B cDNA Clone; TUBA1B cdna clone
Ordering
Sequence
atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctggcaagcacgtgccccgggctgtgtttgtagacttggaacccacagtcattgatgaagttcgcactggcacctaccgccagctcttccaccctgagcagctcatcacaggcaaggaagatgctgccaataactatgcccgagggcactacaccattggcaaggagatcattgaccttgtgttggaccgaattcgcaagctggctgaccagtgcaccggtcttcagggcttcttggttttccacagctttggtgggggaactggttctgggttcacctccctgctcatggaacgtctctcagttgattatggcaagaagtccaagctggagttctccatttacccagcaccccaggtttccacagctgtagttgagccctacaactccatcctcaccacccacaccaccctggagcactctgattgtgccttcatggtagacaatgaggccatctatgacatctgtcgtagaaacctcgatatcgagcgcccaacctacactaaccttaaccgccttattagccagattgtgtcctccatcactgcttccctgagatttgatggagccctgaatgttgacctgacagaattccagaccaacctggtgccctacccccgcatccacttccctctggccacatatgcccctgtcatctctgctgagaaagcctaccatgaacagctttctgtagcagagatcaccaatgcttgctttgagccagccaaccagatggtgaaatgtgaccctcgccatggtaaatacatggcttgctgcctgttgtaccgtggtgacgtggttcccaaagatgtcaatgctgccattgccaccatcaaaaccaagcgcagcatccagtttgtggattggtgccccactggcttcaaggttggcatcaactaccagcctcccactgtggtgcctggtggagacctggccaaggtacagagagctgtgtgcatgctgagcaacaccacagccattgctgaggcctgggctcgcctggaccacaagtttgacctgatgtatgccaagcgtgcctttgttcactggtacgtgggtgaggggatggaggaaggcgagttttcagaggcccgtgaagatatggctgcccttgagaaggattatgaggaggttggtgtggattctgttgaaggagagggtgaggaagaaggagaggaatactaa
Sequence Length
1356
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,218 Da
NCBI Official Full Name
Homo sapiens tubulin, alpha 1b, mRNA
NCBI Official Synonym Full Names
tubulin alpha 1b
NCBI Official Symbol
TUBA1B
NCBI Official Synonym Symbols
K-ALPHA-1
NCBI Protein Information
tubulin alpha-1B chain
UniProt Protein Name
Tubulin alpha-1B chain
UniProt Gene Name
TUBA1B
UniProt Entry Name
TBA1B_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The TUBA1B tuba1b (Catalog #AAA116371) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgtgagt gcatctccat ccacgttggc caggctggtg tccagattgg caatgcctgc tgggagctct actgcctgga acacggcatc cagcccgatg gccagatgcc aagtgacaag accattgggg gaggagatga ctccttcaac accttcttca gtgagacggg cgctggcaag cacgtgcccc gggctgtgtt tgtagacttg gaacccacag tcattgatga agttcgcact ggcacctacc gccagctctt ccaccctgag cagctcatca caggcaagga agatgctgcc aataactatg cccgagggca ctacaccatt ggcaaggaga tcattgacct tgtgttggac cgaattcgca agctggctga ccagtgcacc ggtcttcagg gcttcttggt tttccacagc tttggtgggg gaactggttc tgggttcacc tccctgctca tggaacgtct ctcagttgat tatggcaaga agtccaagct ggagttctcc atttacccag caccccaggt ttccacagct gtagttgagc cctacaactc catcctcacc acccacacca ccctggagca ctctgattgt gccttcatgg tagacaatga ggccatctat gacatctgtc gtagaaacct cgatatcgag cgcccaacct acactaacct taaccgcctt attagccaga ttgtgtcctc catcactgct tccctgagat ttgatggagc cctgaatgtt gacctgacag aattccagac caacctggtg ccctaccccc gcatccactt ccctctggcc acatatgccc ctgtcatctc tgctgagaaa gcctaccatg aacagctttc tgtagcagag atcaccaatg cttgctttga gccagccaac cagatggtga aatgtgaccc tcgccatggt aaatacatgg cttgctgcct gttgtaccgt ggtgacgtgg ttcccaaaga tgtcaatgct gccattgcca ccatcaaaac caagcgcagc atccagtttg tggattggtg ccccactggc ttcaaggttg gcatcaacta ccagcctccc actgtggtgc ctggtggaga cctggccaag gtacagagag ctgtgtgcat gctgagcaac accacagcca ttgctgaggc ctgggctcgc ctggaccaca agtttgacct gatgtatgcc aagcgtgcct ttgttcactg gtacgtgggt gaggggatgg aggaaggcga gttttcagag gcccgtgaag atatggctgc ccttgagaag gattatgagg aggttggtgt ggattctgtt gaaggagagg gtgaggaaga aggagaggaa tactaa. It is sometimes possible for the material contained within the vial of "TUBA1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.