VANGL1 cdna clone
VANGL1 cDNA Clone
Gene Names
VANGL1; LPP2; STB2; STBM2; KITENIN
Synonyms
VANGL1; N/A; VANGL1 cDNA Clone; VANGL1 cdna clone
Sequence
atggataccgaatccacttattctggatattcttactattcaagtcattcgaaaaaatctcacagacaaggggaaagaactagagagagacacaagtcaccccggaataaagacggcagagggtcagaaaagtctgtcaccattcaacctcccactggagagcccctgttgggaaatgattctactcggacagaggaagttcaggatgacaactggggagagaccaccacggccatcacaggcacctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatggaggacagcgtggggctggattgcaaacgctacctgggcctcaccgtcgcctcttttcttggacttctagttttcctcacccctattgccttcatccttttacctccgatcctgtggagggatgagctggagccttgtggcacaatttgtgaggggctctttatctccatggcattcaaactcctcattctgctcatagggacctgggcactttttttccgcaagcggagagctgacatgccacgggtgtttgtgtttcgtgcccttttgttggtcctcatctttctctttgtggtttcctattggcttttttacggggtccgcattttggactctcgggaccggaattaccagggcattgtgcaatatgcagtctcccttgtggatgccctcctcttcatccattacctggccatcgtcctgctggagctcaggcagctgcagcccatgttcacgctgcaggtggtccgctccaccgatggcgagtcccgcttctacagcctgggacacctgagtatccagcgagcagcattggtggtcctagaaaattactacaaagatttcaccatctataacccaaacctcctaacagcctccaaattccgagcagccaagcatatggccgggctgaaagtctacaatgtagatggccccagtaacaatgccactggccagtcccgggccatgattgctgcagctgctcggcgcagggactcaagccacaacgagttgtattatgaagaggccgaacatgaacggcgagtaaagaagcggaaagcaaggctggtggttgcagtggaagaggccttcatccacattcagcgtctccaggctgaggagcagcagaaagccccaggggaggtgatggaccctagggaggccgcccaggccattttcccctccatggccagggctctccagaagtacctgcgcatcacccggcagcagaactaccacagcatggagagcatcctgcagcacctggccttctgcatcaccaacggcatgacccccaaggccttcctagaacggtacctcagtgcgggccccaccctgcaatatgacaaggaccgctggctctctacacagtggaggcttgtcagtgatgaggctgtgactaatggattacgggatggaattgtgttcgtccttaagtgcttggacttcagcctcgtagtcaatgtgaagaaaattccattcatcatactctctgaagagttcatagaccccaaatctcacaaatttgtccttcgcttacagtctgagacatccgtttaa
Sequence Length
1575
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,748 Da
NCBI Official Full Name
Homo sapiens vang-like 1 (van gogh, Drosophila), mRNA
NCBI Official Synonym Full Names
VANGL planar cell polarity protein 1
NCBI Official Symbol
VANGL1
NCBI Official Synonym Symbols
LPP2; STB2; STBM2; KITENIN
NCBI Protein Information
vang-like protein 1
UniProt Protein Name
Vang-like protein 1
UniProt Gene Name
VANGL1
UniProt Synonym Gene Names
STB2; LPP2
UniProt Entry Name
VANG1_HUMAN
Similar Products
Product Notes
The VANGL1 vangl1 (Catalog #AAA116388) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggataccg aatccactta ttctggatat tcttactatt caagtcattc gaaaaaatct cacagacaag gggaaagaac tagagagaga cacaagtcac cccggaataa agacggcaga gggtcagaaa agtctgtcac cattcaacct cccactggag agcccctgtt gggaaatgat tctactcgga cagaggaagt tcaggatgac aactggggag agaccaccac ggccatcaca ggcacctcgg agcacagcat atcccaagag gacattgcca ggatcagcaa ggacatggag gacagcgtgg ggctggattg caaacgctac ctgggcctca ccgtcgcctc ttttcttgga cttctagttt tcctcacccc tattgccttc atccttttac ctccgatcct gtggagggat gagctggagc cttgtggcac aatttgtgag gggctcttta tctccatggc attcaaactc ctcattctgc tcatagggac ctgggcactt tttttccgca agcggagagc tgacatgcca cgggtgtttg tgtttcgtgc ccttttgttg gtcctcatct ttctctttgt ggtttcctat tggctttttt acggggtccg cattttggac tctcgggacc ggaattacca gggcattgtg caatatgcag tctcccttgt ggatgccctc ctcttcatcc attacctggc catcgtcctg ctggagctca ggcagctgca gcccatgttc acgctgcagg tggtccgctc caccgatggc gagtcccgct tctacagcct gggacacctg agtatccagc gagcagcatt ggtggtccta gaaaattact acaaagattt caccatctat aacccaaacc tcctaacagc ctccaaattc cgagcagcca agcatatggc cgggctgaaa gtctacaatg tagatggccc cagtaacaat gccactggcc agtcccgggc catgattgct gcagctgctc ggcgcaggga ctcaagccac aacgagttgt attatgaaga ggccgaacat gaacggcgag taaagaagcg gaaagcaagg ctggtggttg cagtggaaga ggccttcatc cacattcagc gtctccaggc tgaggagcag cagaaagccc caggggaggt gatggaccct agggaggccg cccaggccat tttcccctcc atggccaggg ctctccagaa gtacctgcgc atcacccggc agcagaacta ccacagcatg gagagcatcc tgcagcacct ggccttctgc atcaccaacg gcatgacccc caaggccttc ctagaacggt acctcagtgc gggccccacc ctgcaatatg acaaggaccg ctggctctct acacagtgga ggcttgtcag tgatgaggct gtgactaatg gattacggga tggaattgtg ttcgtcctta agtgcttgga cttcagcctc gtagtcaatg tgaagaaaat tccattcatc atactctctg aagagttcat agaccccaaa tctcacaaat ttgtccttcg cttacagtct gagacatccg tttaa. It is sometimes possible for the material contained within the vial of "VANGL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.