Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

VAV1 cdna clone

VAV1 cDNA Clone

Gene Names
VAV1; VAV
Synonyms
VAV1; N/A; VAV1 cDNA Clone; VAV1 cdna clone
Ordering
Sequence
atgattgtgctaccactgtactccagactggacaaaagattcctgtgccttaagaacattagaaccttcctgtccacctgctgtgagaagttcggcctcaagcggagcgagctcttcgaagcctttgacctcttcgatgtgcaggattttggcaaggtcatctacaccctgtctgctctgtcctggaccccgatcgcccagaacagggggatcatgcccttccccaccgaggaggagagtgtaggtgatgaagacatctacagtggcctgtccgaccagatcgacgacacggtggaggaggatgaggacctgtatgactgcgtggagaatgaggaggcggaaggcgacgagatctatgaggacctcatgcgctcggagcccgtgtccatgccgcccaagatgacagagtatgacaagcgctgctgctgcctgcgggagatccagcagacggaggagaagtacactgacacgctgggctccatccagcagcatttcttgaagcccctgcaacggttcctgaaacctcaagacattgagatcatctttatcaacattgaggacctgcttcgtgttcatactcacttcctaaaggagatgaaggaagccctgggcacccctggcgcagccaatctctaccaggtcttcatcaaatacaaggagaggttcctcgtctatggccgctactgcagccaggtggagtcagccagcaaacacctggaccgtgtggccgcagcccgggaggacgtgcagatgaagctggaggaatgttctcagagagccaacaacgggaggttcaccctgcgggacctgctgatggtgcctatgcagcgagttctcaaatatcacctccttctccaggagctggtgaaacacacgcaggaggcgatggagaaggagaacctgcggctggccctggatgccatgagggacctggctcagtgcgtgaacgaggtcaagcgagacaacgagacactgcgacagatcaccaatttccagctgtccattgagaacctggaccagtctctggctcactatggccggcccaagatcgacggggaactcaagatcacctcggtggaacggcgctccaagatggacaggtatgccttcctgctcgacaaagctctactcatctgtaagcgcaggggagactcctatgacctcaaggactttgtaaacctgcacagcttccaggttcgggatgactcttcaggagaccgagacaacaagaagtggagccacatgttcctcctgatcgaggaccaaggtgcccagggctatgagctgttcttcaagacaagagaattgaagaagaagtggatggagcagtttgagatggccatctccaacatctatccggagaatgccaccgccaacgggcatgacttccagatgttctcctttgaggagaccacatcctgcaaggcctgtcagatgctgcttagaggtaccttctatcagggctaccgctgccatcggtgccgggcatctgcacacaaggagtgtctggggagggtccctccatgtggccgacatgggcaagatttcccaggaactatgaagaaggacaaactacatcgcagggctcaggacaaaaagaggaatgagctgggtctgcccaagatggaggtgtttcaggaatactacgggcttcctccaccccctggagccattggaccctttctacggctcaaccctggagacattgtggagctcacgaaggctgaggctgaacagaactggtgggagggcagaaatacatctactaatgaaattggctggtttccttgtaacagggtgaagccctatgtccatggccctcctcaggacctgtctgttcatctctggtacgcaggccccatggagcgggcaggggcagagagcatcctggccaaccgctcggacgggactttcttggtgcggcagagggtgaaggatgcagcagaatttgccatcagcattaaatataacgtcgaggtcaagcacattaaaatcatgacagcagaaggactgtaccggatcacagagaaaaaggctttccgggggcttacggagctggtggagttttaccagcagaactctctaaaggattgcttcaagtctctggacaccaccttgcagttccccttcaaggagcctgaaaagagaaccatcagcaggccagcagtgggaagcacaaagtattttggcacagccaaagcccgctatgacttctgcgcccgagaccgatcagagctgtcgctcaaggagggtgacatcatcaagatccttaacaagaagggacagcaaggctggtggcgaggggagatctatggccgggttggctggttccctgccaactacgtggaggaagattattctgaatactgctga
Sequence Length
2373
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
94,493 Da
NCBI Official Full Name
Homo sapiens vav 1 guanine nucleotide exchange factor, mRNA
NCBI Official Synonym Full Names
vav guanine nucleotide exchange factor 1
NCBI Official Symbol
VAV1
NCBI Official Synonym Symbols
VAV
NCBI Protein Information
proto-oncogene vav
UniProt Protein Name
Proto-oncogene vav
UniProt Gene Name
VAV1
UniProt Synonym Gene Names
VAV
UniProt Entry Name
VAV_HUMAN

Similar Products

Product Notes

The VAV1 vav1 (Catalog #AAA116359) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgtgc taccactgta ctccagactg gacaaaagat tcctgtgcct taagaacatt agaaccttcc tgtccacctg ctgtgagaag ttcggcctca agcggagcga gctcttcgaa gcctttgacc tcttcgatgt gcaggatttt ggcaaggtca tctacaccct gtctgctctg tcctggaccc cgatcgccca gaacaggggg atcatgccct tccccaccga ggaggagagt gtaggtgatg aagacatcta cagtggcctg tccgaccaga tcgacgacac ggtggaggag gatgaggacc tgtatgactg cgtggagaat gaggaggcgg aaggcgacga gatctatgag gacctcatgc gctcggagcc cgtgtccatg ccgcccaaga tgacagagta tgacaagcgc tgctgctgcc tgcgggagat ccagcagacg gaggagaagt acactgacac gctgggctcc atccagcagc atttcttgaa gcccctgcaa cggttcctga aacctcaaga cattgagatc atctttatca acattgagga cctgcttcgt gttcatactc acttcctaaa ggagatgaag gaagccctgg gcacccctgg cgcagccaat ctctaccagg tcttcatcaa atacaaggag aggttcctcg tctatggccg ctactgcagc caggtggagt cagccagcaa acacctggac cgtgtggccg cagcccggga ggacgtgcag atgaagctgg aggaatgttc tcagagagcc aacaacggga ggttcaccct gcgggacctg ctgatggtgc ctatgcagcg agttctcaaa tatcacctcc ttctccagga gctggtgaaa cacacgcagg aggcgatgga gaaggagaac ctgcggctgg ccctggatgc catgagggac ctggctcagt gcgtgaacga ggtcaagcga gacaacgaga cactgcgaca gatcaccaat ttccagctgt ccattgagaa cctggaccag tctctggctc actatggccg gcccaagatc gacggggaac tcaagatcac ctcggtggaa cggcgctcca agatggacag gtatgccttc ctgctcgaca aagctctact catctgtaag cgcaggggag actcctatga cctcaaggac tttgtaaacc tgcacagctt ccaggttcgg gatgactctt caggagaccg agacaacaag aagtggagcc acatgttcct cctgatcgag gaccaaggtg cccagggcta tgagctgttc ttcaagacaa gagaattgaa gaagaagtgg atggagcagt ttgagatggc catctccaac atctatccgg agaatgccac cgccaacggg catgacttcc agatgttctc ctttgaggag accacatcct gcaaggcctg tcagatgctg cttagaggta ccttctatca gggctaccgc tgccatcggt gccgggcatc tgcacacaag gagtgtctgg ggagggtccc tccatgtggc cgacatgggc aagatttccc aggaactatg aagaaggaca aactacatcg cagggctcag gacaaaaaga ggaatgagct gggtctgccc aagatggagg tgtttcagga atactacggg cttcctccac cccctggagc cattggaccc tttctacggc tcaaccctgg agacattgtg gagctcacga aggctgaggc tgaacagaac tggtgggagg gcagaaatac atctactaat gaaattggct ggtttccttg taacagggtg aagccctatg tccatggccc tcctcaggac ctgtctgttc atctctggta cgcaggcccc atggagcggg caggggcaga gagcatcctg gccaaccgct cggacgggac tttcttggtg cggcagaggg tgaaggatgc agcagaattt gccatcagca ttaaatataa cgtcgaggtc aagcacatta aaatcatgac agcagaagga ctgtaccgga tcacagagaa aaaggctttc cgggggctta cggagctggt ggagttttac cagcagaact ctctaaagga ttgcttcaag tctctggaca ccaccttgca gttccccttc aaggagcctg aaaagagaac catcagcagg ccagcagtgg gaagcacaaa gtattttggc acagccaaag cccgctatga cttctgcgcc cgagaccgat cagagctgtc gctcaaggag ggtgacatca tcaagatcct taacaagaag ggacagcaag gctggtggcg aggggagatc tatggccggg ttggctggtt ccctgccaac tacgtggagg aagattattc tgaatactgc tga. It is sometimes possible for the material contained within the vial of "VAV1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.