Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

WDR65 cdna clone

WDR65 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
CFAP57; VWS2; WDR65
Synonyms
WDR65; N/A; WDR65 cDNA Clone; WDR65 cdna clone
Ordering
Sequence
atgtcagccgtggtagctcagacgctgcatgtttttggtcttcgatcccacgtggccaacaatatcttctacttcgatgaacagatcattatatttccttcaggaaatcactgtgtgaagtacaatgtggatcagaaatggcaaaaattcattccaggctcagagaagagtcagggcatgttggccttgtccatcagtcccaatcggcggtacctcgctatctctgagactgtgcaagaaaaacctgccatcaccatttatgaattgtcatccatcccttgccggaagcgcaaagttcttaataattttgacttccaagttcagaaatttattagcatggctttttctccagactccaaatacctattggctcagacgtcacctccagagtcaaatcttgtctactggctgtgggaaaaacagaaagtaatggccattgttagaatcgacactcagaacaaccctgtctaccaggtgagcttcagtccacaggataacactcaggtgtgtgtcactggaaatgggatgtttaagcttctccgttttgctgagggaaccctgaagcaaaccagctttcagaggggagaaccccaaaactatctagctcacacctgggtggctgatgacaagattgtcgttggcactgacacaggcaaactcttcctctttgaatctggagatcagcgttgggagaccagcataatggtcaaggaacctaccaatggctcaaagagcctggatgtcattcaggaatcagagagcctgattgaatttccaccagtcagttctccactcccttcctatgaacagatggtggcggccagtagccatagccagatgtccatgccccaggtgtttgccattgcagcctattcaaagggatttgcctgttctgctgggccagggagagttctgctgtttgagaagatggaagaaaaggatttttaccgtgagagcagagaaatcaggattcctgtggacccgcagagcaatgatccaagtcagtctgacaaacaggacgttctctgcctgtgcttcagcccctcagaggaaactctggttgccagcaccagtaagaaccaactctacagcatcaccatgtccctgacagagatcagcaagggggagcctgctcactttgagtatttgatgtatccattgcactcagcacccatcaccggtctagctacctgcatccgcaaaccccttatagccacctgttctctggatcgatccatccgcctttggaattatgaaacaaacaccctggaactatttaaggaataccaagaagaggcatattccatcagccttcatccatctggacacttcattgtagtagggtttgctgacaaactacgcctcatgaatctactcattgatgatatacgttctttcaaagaatactctgttagaggatgcggagagtgttcctttagcaatggaggtcacctgtttgctgcagtcaatggaaatgtgattcacgtttacaccaccacgagcctagagaacatctcaagcctgaaaggacacacagggaagattcgctcaattgtgtggaatgcagatgatagcaaactgatttctggtggcacagatggtgctgtgtatgaatggaatctgtccacaggaaagagagagacagaatgcgtgctcaagtcttgcagctacaactgtgttactgtctcccccgatgccaaaattatctttgctgttggatcagaccacaccctcaaggagattgcagattccttgatccttcgagagatatcggcgtttgatgtcacctacaccgccattgtcatctcacattctggacgcatgatgtttgtgggcacctcggtgggaaccattcgtgccatgaagtaccctctgcctctgcagaaggaattcaatgagtaccaggcccatgccggtcctatcaccaaggtgagcagggccctctccccaggaacccagtcccacacctgcctgctacgtgccttgttcatcccttcaacctcccaatgtcttttctctctccttcttctctcttatttattcatccatcattcattgaatcaccatctattgactatgaatatactctttgtttaa
Sequence Length
2097
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
78,164 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 65, mRNA
NCBI Official Synonym Full Names
cilia and flagella associated protein 57
NCBI Official Symbol
CFAP57
NCBI Official Synonym Symbols
VWS2; WDR65
NCBI Protein Information
cilia- and flagella-associated protein 57
UniProt Protein Name
Cilia- and flagella-associated protein 57
UniProt Gene Name
CFAP57
UniProt Entry Name
CFA57_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The WDR65 cfap57 (Catalog #AAA116414) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagccg tggtagctca gacgctgcat gtttttggtc ttcgatccca cgtggccaac aatatcttct acttcgatga acagatcatt atatttcctt caggaaatca ctgtgtgaag tacaatgtgg atcagaaatg gcaaaaattc attccaggct cagagaagag tcagggcatg ttggccttgt ccatcagtcc caatcggcgg tacctcgcta tctctgagac tgtgcaagaa aaacctgcca tcaccattta tgaattgtca tccatccctt gccggaagcg caaagttctt aataattttg acttccaagt tcagaaattt attagcatgg ctttttctcc agactccaaa tacctattgg ctcagacgtc acctccagag tcaaatcttg tctactggct gtgggaaaaa cagaaagtaa tggccattgt tagaatcgac actcagaaca accctgtcta ccaggtgagc ttcagtccac aggataacac tcaggtgtgt gtcactggaa atgggatgtt taagcttctc cgttttgctg agggaaccct gaagcaaacc agctttcaga ggggagaacc ccaaaactat ctagctcaca cctgggtggc tgatgacaag attgtcgttg gcactgacac aggcaaactc ttcctctttg aatctggaga tcagcgttgg gagaccagca taatggtcaa ggaacctacc aatggctcaa agagcctgga tgtcattcag gaatcagaga gcctgattga atttccacca gtcagttctc cactcccttc ctatgaacag atggtggcgg ccagtagcca tagccagatg tccatgcccc aggtgtttgc cattgcagcc tattcaaagg gatttgcctg ttctgctggg ccagggagag ttctgctgtt tgagaagatg gaagaaaagg atttttaccg tgagagcaga gaaatcagga ttcctgtgga cccgcagagc aatgatccaa gtcagtctga caaacaggac gttctctgcc tgtgcttcag cccctcagag gaaactctgg ttgccagcac cagtaagaac caactctaca gcatcaccat gtccctgaca gagatcagca agggggagcc tgctcacttt gagtatttga tgtatccatt gcactcagca cccatcaccg gtctagctac ctgcatccgc aaacccctta tagccacctg ttctctggat cgatccatcc gcctttggaa ttatgaaaca aacaccctgg aactatttaa ggaataccaa gaagaggcat attccatcag ccttcatcca tctggacact tcattgtagt agggtttgct gacaaactac gcctcatgaa tctactcatt gatgatatac gttctttcaa agaatactct gttagaggat gcggagagtg ttcctttagc aatggaggtc acctgtttgc tgcagtcaat ggaaatgtga ttcacgttta caccaccacg agcctagaga acatctcaag cctgaaagga cacacaggga agattcgctc aattgtgtgg aatgcagatg atagcaaact gatttctggt ggcacagatg gtgctgtgta tgaatggaat ctgtccacag gaaagagaga gacagaatgc gtgctcaagt cttgcagcta caactgtgtt actgtctccc ccgatgccaa aattatcttt gctgttggat cagaccacac cctcaaggag attgcagatt ccttgatcct tcgagagata tcggcgtttg atgtcaccta caccgccatt gtcatctcac attctggacg catgatgttt gtgggcacct cggtgggaac cattcgtgcc atgaagtacc ctctgcctct gcagaaggaa ttcaatgagt accaggccca tgccggtcct atcaccaagg tgagcagggc cctctcccca ggaacccagt cccacacctg cctgctacgt gccttgttca tcccttcaac ctcccaatgt cttttctctc tccttcttct ctcttattta ttcatccatc attcattgaa tcaccatcta ttgactatga atatactctt tgtttaa. It is sometimes possible for the material contained within the vial of "WDR65, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.