Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

ZBP1 cdna clone

ZBP1 cDNA Clone

Gene Names
ZBP1; DAI; DLM1; DLM-1; C20orf183
Synonyms
ZBP1; N/A; ZBP1 cDNA Clone; ZBP1 cdna clone
Ordering
Sequence
atggcccaggctcctgctgacccgggcagagaaggccaccttgaacaaagaatcctgcaggtgctgacagaggctggctccccggtgaaacttgcccagctggtgaaggaatgccaagcacccaagagggagctcaaccaagtcctctaccgaatgaaaaaggagttgaaagtctccctcacatcccctgccacctggtgcttgggcgggactgatcctgaaggcgagggtcctgcagagctggccttgtccagccctggtaactgccaccccggggaggcgggtctgaccctgcagggagcatcctggcaatggacaagcacagatttgagcctgggttcgaatctgaactctgccacatgggagctcacaggtttcctctctctgtgccttggtttctttttctggttgatggagctcacagcagggctgcttggtaggggttgctga
Sequence Length
450
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
46,343 Da
NCBI Official Full Name
Homo sapiens Z-DNA binding protein 1, mRNA
NCBI Official Synonym Full Names
Z-DNA binding protein 1
NCBI Official Symbol
ZBP1
NCBI Official Synonym Symbols
DAI; DLM1; DLM-1; C20orf183
NCBI Protein Information
Z-DNA-binding protein 1; DNA-dependent activator of IRFs; DNA-dependent activator of IFN-regulatory factors; tumor stroma and activated macrophage protein DLM-1; DNA-dependent activator of interferon regulatory factors
UniProt Protein Name
Z-DNA-binding protein 1
UniProt Gene Name
ZBP1
UniProt Synonym Gene Names
C20orf183; DLM1
UniProt Entry Name
ZBP1_HUMAN

Similar Products

Product Notes

The ZBP1 zbp1 (Catalog #AAA116317) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagg ctcctgctga cccgggcaga gaaggccacc ttgaacaaag aatcctgcag gtgctgacag aggctggctc cccggtgaaa cttgcccagc tggtgaagga atgccaagca cccaagaggg agctcaacca agtcctctac cgaatgaaaa aggagttgaa agtctccctc acatcccctg ccacctggtg cttgggcggg actgatcctg aaggcgaggg tcctgcagag ctggccttgt ccagccctgg taactgccac cccggggagg cgggtctgac cctgcaggga gcatcctggc aatggacaag cacagatttg agcctgggtt cgaatctgaa ctctgccaca tgggagctca caggtttcct ctctctgtgc cttggtttct ttttctggtt gatggagctc acagcagggc tgcttggtag gggttgctga. It is sometimes possible for the material contained within the vial of "ZBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.