ZBTB24 cDNA Clone – Homo Sapiens Zinc Finger And BTB Domain Containing 24, Mrna
ZBTB24 cDNA Clone
Gene Names
ZBTB24; BIF1; ICF2; PATZ2; ZNF450
Synonyms
ZBTB24; N/A; ZBTB24 cDNA Clone; ZBTB24 cdna clone
Product Overview
Sequence
atggcagaaacatcgccagagccttctgggcagcttgttgtacactcagacgctcacagtgacactgtgctggccagttttgaggatcagaggaagaaaggcttcctctgtgacattactttaatcgtggagaatgtacatttccgggcccacaaagccttacttgctgccagtagtgaatacttctcaatgatgtttgcagaagagggggaaatcggccaatccatttatatgctggaaggcatggttgcagacacctttggtatcctgctggaatttatctacacaggttatctccatgccagtgagaaaagtacagaacaaatcctggctactgctcagttcttaaaagtctatgacctggtaaaggcttacacagacttccaaaataatcatagctccccaaagccaacaactttgaacactgctggtgccccagtggttgttatctctaataagaaaaacgatcctccaaagcggaaacggggaagaccaaaaaaagtcaatacattgcaggaggagaaatcagaactggctgcagaggaagaaatacagttaagagtgaacaattcagttcagaatagacaaaactttgtggttaaaggagacagtggtgtactgaatgagcaaattgcagcaaaagaaaaggaagaatcggagcctacttgtgagccaagtagagaggaggaaatgccagttgaaaaagatgagaactatgatcccaagaccgaggatggccaggcaagccagagtcgatacagcaagcggaggatttggagatccgtcaaacttaaagattacaaacttgttggggatcaagaggaccatggttcagccaagaggatctgtggaaggagaaagcgccctggaggccctgaggcccgctgtaaagactgtggcaaggtctttaagtacaatcactttttagcaatccaccagaggagccacacaggtaatgatgttttcaaagctgattgcagtgtgttgcagaattgggagtag
Sequence Length
1002
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,620 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 24, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 24
NCBI Official Symbol
ZBTB24
NCBI Official Synonym Symbols
BIF1; ICF2; PATZ2; ZNF450
NCBI Protein Information
zinc finger and BTB domain-containing protein 24
UniProt Protein Name
Zinc finger and BTB domain-containing protein 24
UniProt Gene Name
ZBTB24
UniProt Synonym Gene Names
KIAA0441; ZNF450
UniProt Entry Name
ZBT24_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The ZBTB24 zbtb24 (Catalog #AAA116285) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaaa catcgccaga gccttctggg cagcttgttg tacactcaga cgctcacagt gacactgtgc tggccagttt tgaggatcag aggaagaaag gcttcctctg tgacattact ttaatcgtgg agaatgtaca tttccgggcc cacaaagcct tacttgctgc cagtagtgaa tacttctcaa tgatgtttgc agaagagggg gaaatcggcc aatccattta tatgctggaa ggcatggttg cagacacctt tggtatcctg ctggaattta tctacacagg ttatctccat gccagtgaga aaagtacaga acaaatcctg gctactgctc agttcttaaa agtctatgac ctggtaaagg cttacacaga cttccaaaat aatcatagct ccccaaagcc aacaactttg aacactgctg gtgccccagt ggttgttatc tctaataaga aaaacgatcc tccaaagcgg aaacggggaa gaccaaaaaa agtcaataca ttgcaggagg agaaatcaga actggctgca gaggaagaaa tacagttaag agtgaacaat tcagttcaga atagacaaaa ctttgtggtt aaaggagaca gtggtgtact gaatgagcaa attgcagcaa aagaaaagga agaatcggag cctacttgtg agccaagtag agaggaggaa atgccagttg aaaaagatga gaactatgat cccaagaccg aggatggcca ggcaagccag agtcgataca gcaagcggag gatttggaga tccgtcaaac ttaaagatta caaacttgtt ggggatcaag aggaccatgg ttcagccaag aggatctgtg gaaggagaaa gcgccctgga ggccctgagg cccgctgtaa agactgtggc aaggtcttta agtacaatca ctttttagca atccaccaga ggagccacac aggtaatgat gttttcaaag ctgattgcag tgtgttgcag aattgggagt ag. It is sometimes possible for the material contained within the vial of "ZBTB24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.