Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

ZBTB38 cdna clone

ZBTB38 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
ZBTB38; CIBZ; ZNF921; PPP1R171
Synonyms
ZBTB38; N/A; ZBTB38 cDNA Clone; ZBTB38 cdna clone
Ordering
Sequence
atgcaggaggagcctttgccacaggggaatgacccagaacccagtggagacagcccactcgggctttgccaatccgagtgcatggagatgagtgaagtgttcgatgacgcaagtgaccaggattccactgacaaaccgtggcgcccttactacaactacaaacccaaaaagaaatccagacagttgaaaaaaatgaggaaagtcaactggaggaaggagcacggaaacaggagcccgagccataaatgtaaatacccagcagaactggattgcgccgtggggaaggctcctcaggataaaccctttgaggaagaagaaactaaagagatgcccaagctgcagtgtgaactctgtgatggagacaaagcagtgggggctggaaaccaaggaaggccccaccgacatcttacttctcggccatatgcctgcgagctctgcgccaagcagttccagagcccttccacactcaaaatgcacatgagatgtcacaccggggagaagccataccagtgcaagacctgcggacggtgcttttcggtgcaaggaaacttacagaaacatgaacgcatccacctgggcttgaaggagttcgtctgtcagtattgcaacaaggcattcaccttgaatgagaccctcaaaatccatgaaagaatccatactggagaaaagcgttaccactgtcagttctgctttcagagatttttgtatctctccaccaaaaggaatcacgagcagaggcatattcgggagcataatgggaagggctatgcctgcttccagtgccccaaaatttgcaaaacagctgctgcccttggaatgcaccaaaagaaacacttattcaaaagcccaagtcagcaggagaaaataggtgacgtgtgccacgaaaactcaaatcccttggagaatcaacatttcattggttcagaagacaatgaccaaaaggataacatacaaaccggtgtggaaaatgttgtcctttga
Sequence Length
981
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
134,257 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 38, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 38
NCBI Official Symbol
ZBTB38
NCBI Official Synonym Symbols
CIBZ; ZNF921; PPP1R171
NCBI Protein Information
zinc finger and BTB domain-containing protein 38
UniProt Protein Name
Zinc finger and BTB domain-containing protein 38
UniProt Gene Name
ZBTB38
UniProt Entry Name
ZBT38_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The ZBTB38 zbtb38 (Catalog #AAA116440) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggagg agcctttgcc acaggggaat gacccagaac ccagtggaga cagcccactc gggctttgcc aatccgagtg catggagatg agtgaagtgt tcgatgacgc aagtgaccag gattccactg acaaaccgtg gcgcccttac tacaactaca aacccaaaaa gaaatccaga cagttgaaaa aaatgaggaa agtcaactgg aggaaggagc acggaaacag gagcccgagc cataaatgta aatacccagc agaactggat tgcgccgtgg ggaaggctcc tcaggataaa ccctttgagg aagaagaaac taaagagatg cccaagctgc agtgtgaact ctgtgatgga gacaaagcag tgggggctgg aaaccaagga aggccccacc gacatcttac ttctcggcca tatgcctgcg agctctgcgc caagcagttc cagagccctt ccacactcaa aatgcacatg agatgtcaca ccggggagaa gccataccag tgcaagacct gcggacggtg cttttcggtg caaggaaact tacagaaaca tgaacgcatc cacctgggct tgaaggagtt cgtctgtcag tattgcaaca aggcattcac cttgaatgag accctcaaaa tccatgaaag aatccatact ggagaaaagc gttaccactg tcagttctgc tttcagagat ttttgtatct ctccaccaaa aggaatcacg agcagaggca tattcgggag cataatggga agggctatgc ctgcttccag tgccccaaaa tttgcaaaac agctgctgcc cttggaatgc accaaaagaa acacttattc aaaagcccaa gtcagcagga gaaaataggt gacgtgtgcc acgaaaactc aaatcccttg gagaatcaac atttcattgg ttcagaagac aatgaccaaa aggataacat acaaaccggt gtggaaaatg ttgtcctttg a. It is sometimes possible for the material contained within the vial of "ZBTB38, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.