WB (Western Blot)
(Western blot analysis of lysates from U-251MG cells, using FGFR1 Rabbit mAb (AAA283012) at 1:3600 dilution.Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.Lysates/proteins: 25ug per lane.Blocking buffer: 3% nonfat dry milk in TBST.Detection: ECL Basic Kit (RM00020).Exposure time: 10s.)
Rabbit anti-Human FGFR1 Monoclonal Antibody | anti-FGFR1 antibody
FGFR1 Rabbit mAb
Reactivity
Human
Applications
ELISA, Western Blot
Purity
Affinity purification
Synonyms
FGFR1, Antibody; FGFR1 Rabbit mAb; CEK; FLG; HH2; OGD; ECCL; FLT2; KAL2; BFGFR; CD331; FGFBR; FLT-2; HBGFR; N-SAM; FGFR-1; HRTFDS; bFGF-R-1; FGFR1; anti-FGFR1 antibody
Host
Rabbit
Reactivity
Human
Clonality
Monoclonal
Isotype
IgG
Purity/Purification
Affinity purification
Form/Format
PBS with 0.05% proclin300, 0.05% BSA, 50% glycerol, pH7.3.
Sequence
GTGGAAGTGGAGTCCTTCCTGGTCCACCCCGGTGACCTGCTGCAGCTTCGCTGTCGGCTGCGGGACGATGTGCAGAGCATCAACTGGCTGCGGGACGGGGTGCAGCTGGCGGAAAGCAACCGCACCCGCATCACAGGGGAGGAGGTGGAGGTGCAGGACTCCGTGCCCGCAGACTCCGGCCTCTATGCTTGCGTAACCAGCAGCCCCTCGGGCAGTGACACCACCTACTTCTCCGTCAATGTTTCAGATGCTCTCCCC
Applicable Applications for anti-FGFR1 antibody
ELISA, WB (Western Blot)
Cross Reactivity
Human, Mouse, Rat
Immunogen
Recombinant fusion protein containing a sequence corresponding to amino acids 38-123 of human FGFR1 (NP_075598.2).
Preparation and Storage
Store at -20 degree C. Avoid freeze/thaw cycles.
WB (Western Blot)
(Western blot analysis of lysates from U-251MG cells, using FGFR1 Rabbit mAb (AAA283012) at 1:3600 dilution.Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.Lysates/proteins: 25ug per lane.Blocking buffer: 3% nonfat dry milk in TBST.Detection: ECL Basic Kit (RM00020).Exposure time: 10s.)
WB (Western Blot)
(Western blot analysis of lysates from U-251MG cells, using FGFR1 Rabbit mAb (AAA283012) at 1:3600 dilution.Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.Lysates/proteins: 25ug per lane.Blocking buffer: 3% nonfat dry milk in TBST.Detection: ECL Basic Kit (RM00020).Exposure time: 10s.)
WB (Western Blot)
(Western blot analysis of various lysates, using FGFR1 Rabbit mAb (AAA283012) at 1:3600 dilution.Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.Lysates/proteins: 25ug per lane.Blocking buffer: 3% nonfat dry milk in TBST.Detection: ECL Basic Kit (RM00020).Exposure time: 10s.)
WB (Western Blot)
(Western blot analysis of various lysates, using FGFR1 Rabbit mAb (AAA283012) at 1:3600 dilution.Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.Lysates/proteins: 25ug per lane.Blocking buffer: 3% nonfat dry milk in TBST.Detection: ECL Basic Kit (RM00020).Exposure time: 10s.)
Related Product Information for anti-FGFR1 antibody
The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized.
Product Categories/Family for anti-FGFR1 antibody
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
Molecular Weight
Calculated MW: 92kDa
Observed MW: 122kDa
Observed MW: 122kDa
UniProt Protein Name
Fibroblast growth factor receptor 1
UniProt Gene Name
FGFR1
UniProt Synonym Gene Names
BFGFR; CEK; FGFBR; FLG; FLT2; HBGFR; FGFR-1; BFGFR; bFGF-R-1; FLT-2
UniProt Entry Name
FGFR1_HUMAN
Similar Products
Product Notes
The FGFR1 fgfr1 (Catalog #AAA283012) is an Antibody produced from Rabbit and is intended for research purposes only. The product is available for immediate purchase. The FGFR1 Rabbit mAb reacts with Human and may cross-react with other species as described in the data sheet. AAA Biotech's FGFR1 can be used in a range of immunoassay formats including, but not limited to, ELISA, WB (Western Blot). Researchers should empirically determine the suitability of the FGFR1 fgfr1 for an application not listed in the data sheet. Researchers commonly develop new applications and it is an integral, important part of the investigative research process. The amino acid sequence is listed below: GTGGAAGTGG AGTCCTTCCT GGTCCACCCC GGTGACCTGC TGCAGCTTCG CTGTCGGCTG CGGGACGATG TGCAGAGCAT CAACTGGCTG CGGGACGGGG TGCAGCTGGC GGAAAGCAAC CGCACCCGCA TCACAGGGGA GGAGGTGGAG GTGCAGGACT CCGTGCCCGC AGACTCCGGC CTCTATGCTT GCGTAACCAG CAGCCCCTCG GGCAGTGACA CCACCTACTT CTCCGTCAAT GTTTCAGATG CTCTCCCC. It is sometimes possible for the material contained within the vial of "FGFR1, Monoclonal Antibody" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.