Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us
product-image-AAA44662_AD15.jpg Application Data (The vector contains the ampicillin-resistance gene, MMLV LTRs, package signal, CMV promoter and MCS for cloning of gene of interest (Figure 1).)

pMXs-CMV vector

pMXs-CMV Retroviral Vector

Synonyms
pMXs-CMV; N/A; pMXs-CMV Retroviral Vector; pMXs-CMV vector
Ordering
Concentration
10 µg at 0.25 µg/µL in TE (varies by lot)
5-MCS
Enzyme Sites: 5’-BamHI, BstXI, EcoRI, HindIII-3’
MCS Sequence: TGAAGGATCCCAGTGTGGTGGTACGGGAATTCAAGCTTGATC
3-MCS
Enzyme Sites: 5’-HpaI, BstXI, EcoRI, BlpI, XhoI, NotI, BstXI, SalI-3
MCS Sequence:TGGCGTTAACTCGGCGTTTCATCTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGCTGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCATTCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATTATGTACTATTTAAACTCGAGCGGCCGCCAGCACAGTGGTCGACGATA
Note: For optimal expression, both 5’ MCS and 3’ MCS should be used to clone gene of interest and replace the stuffer sequence between them.
Safety Consideration
Remember that you will be working with samples containing infectious virus. Follow the recommended NIH guidelines for all materials containing BSL-2 organisms. Always wear gloves, use filtered tips and work under a biosafety hood.
Preparation and Storage
Store at -20°C.

Application Data

(The vector contains the ampicillin-resistance gene, MMLV LTRs, package signal, CMV promoter and MCS for cloning of gene of interest (Figure 1).)

product-image-AAA44662_AD15.jpg Application Data (The vector contains the ampicillin-resistance gene, MMLV LTRs, package signal, CMV promoter and MCS for cloning of gene of interest (Figure 1).)
Related Product Information for pMXs-CMV vector
Retroviruses are efficient tools for delivering heritable genes into the genome of dividing cells. pMXs-CMV retroviral vector is based on Moloney murine leukemia virus (MMLV). The vector provides the viral package signal, transcription and processing elements, and MCS for cloning of a target gene. The viral env gene, produced by the package cell line, encodes the envelope protein, which determines the viral infectivity range. Transfection into a package cell line produces high-titer, replication-incompetent viruses. In addition to transfer and expression of exogenous genes in mammalian cells, recently, retroviruses have been used to express silencing RNAs (siRNA) to decrease the expression of target genes both in vitro and in vivo.

Similar Products

Product Notes

The pMXs-CMV (Catalog #AAA44662) is a Vector and is intended for research purposes only. The product is available for immediate purchase. It is sometimes possible for the material contained within the vial of "pMXs-CMV, Vector" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.