Sequence
atgtctactgttcacgaaatcctgtgcaagctcagcttggagggtgatcactctacacccccaagtgcatatgggtctgtcaaagcctatactaactttgatgctgagcgggatgctttgaacattgaaacagccatcaagaccaaaggtgtggatgaggtcaccattgtcaacattttgaccaaccgcagcaatgcacagagacaggatattgccttcgcctaccagagaaggaccaaaaaggaacttgcatcagcactgaagtcagccttatctggccacctggagacgttgattttgggcctattgaagacacctgctcagtatgacgcttctgagctaaaagcttccatgaaggggctgggaaccgacgaggactctctcattgagatcatctgctccagaaccaaccaggagctgcaggaaattaacagagtctacaaggaaatgtacaagactgatctggagaaggacattatttcggacacatctggtgacttccgcaagctgatggttgccctggcaaagggtagaagagcagaggatggctctgtcattgattatgaactgattgaccaagatgctcgggatctctatgacgctggagtgaagaggaaaggaactgatgttcccaagtggatcagcatcatgaccgagcggagcgtgccccacctccagaaagtatttgataggtacaagagttacagcccttatgacatgttggaaagcatcaggaaagaggttaaaggagacctggaaaatgctttcctgaacctggttcagtgcattcagaacaagcccctgtattttgctgatcggctgtatgactccatgaagggcaaggggacgcgagataaggtcctgatcagaatcatggtctcccgcagtgaagtggacatgttgaaaattaggtctgaattcaagagaaagtacggcaagtccctgtactattatatccagcaagacactaagggcgactaccagaaagcgctgctgtacctgtgtggtggagatgactga
Sequence Length
1020
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Related Product Information for ANXA2 cdna clone
Homo sapiens annexin A2, mRNA (cDNA clone MGC:10129 IMAGE:3901641),complete cds.
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,604 Da
NCBI Official Full Name
Homo sapiens annexin A2, mRNA
NCBI Official Synonym Full Names
annexin A2
NCBI Official Symbol
ANXA2
NCBI Official Synonym Symbols
P36; ANX2; LIP2; LPC2; CAL1H; LPC2D; ANX2L4; PAP-IV
NCBI Protein Information
annexin A2; annexin-2; protein I; annexin II; lipocortin II; chromobindin 8; chromobindin-8; calpactin I heavy chain; calpactin-1 heavy chain; calpactin I heavy polypeptide; placental anticoagulant protein IV
UniProt Protein Name
Annexin A2
UniProt Gene Name
ANXA2
UniProt Synonym Gene Names
ANX2; ANX2L4; CAL1H; LPC2D; PAP-IV
UniProt Entry Name
ANXA2_HUMAN
Similar Products
Product Notes
The ANXA2 anxa2 (Catalog #AAA116424) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctactg ttcacgaaat cctgtgcaag ctcagcttgg agggtgatca ctctacaccc ccaagtgcat atgggtctgt caaagcctat actaactttg atgctgagcg ggatgctttg aacattgaaa cagccatcaa gaccaaaggt gtggatgagg tcaccattgt caacattttg accaaccgca gcaatgcaca gagacaggat attgccttcg cctaccagag aaggaccaaa aaggaacttg catcagcact gaagtcagcc ttatctggcc acctggagac gttgattttg ggcctattga agacacctgc tcagtatgac gcttctgagc taaaagcttc catgaagggg ctgggaaccg acgaggactc tctcattgag atcatctgct ccagaaccaa ccaggagctg caggaaatta acagagtcta caaggaaatg tacaagactg atctggagaa ggacattatt tcggacacat ctggtgactt ccgcaagctg atggttgccc tggcaaaggg tagaagagca gaggatggct ctgtcattga ttatgaactg attgaccaag atgctcggga tctctatgac gctggagtga agaggaaagg aactgatgtt cccaagtgga tcagcatcat gaccgagcgg agcgtgcccc acctccagaa agtatttgat aggtacaaga gttacagccc ttatgacatg ttggaaagca tcaggaaaga ggttaaagga gacctggaaa atgctttcct gaacctggtt cagtgcattc agaacaagcc cctgtatttt gctgatcggc tgtatgactc catgaagggc aaggggacgc gagataaggt cctgatcaga atcatggtct cccgcagtga agtggacatg ttgaaaatta ggtctgaatt caagagaaag tacggcaagt ccctgtacta ttatatccag caagacacta agggcgacta ccagaaagcg ctgctgtacc tgtgtggtgg agatgactga. It is sometimes possible for the material contained within the vial of "ANXA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
