ARHGEF9 cdna clone
ARHGEF9 cDNA Clone
Gene Names
ARHGEF9; PEM2; EIEE8; PEM-2; HPEM-2; COLLYBISTIN
Synonyms
ARHGEF9; N/A; ARHGEF9 cDNA Clone; ARHGEF9 cdna clone
Sequence
atgacgttgctgatcactggagattccatcgttagtgctgaggcagtatgggatcacgtcaccatggccaaccgggagttggcatttaaagctggcgacgtcatcaaagtcttggatgcttccaacaaggattggtggtggggccagatcgacgatgaggagggatggtttcctgccagctttgtgaggctctgggtgaaccaggaggatgaggtggaggaggggcccagcgatgtgcagaacggacacctggaccccaattcagactgcctctgtctggggcggccactacagaaccgggaccagatgcgggccaatgtcatcaatgagataatgagcactgagcgtcactacatcaagcacctcaaggatatttgtgagggctatctgaagcagtgccggaagagaagggacatgttcagtgacgagcaactgaaggtaatctttgggaacattgaagatatctacagatttcagatgggctttgtgagagacctggagaaacagtataacaatgatgacccccacctcagcgagataggaccctgcttcctagagcaccaagatggattctggatatactctgagtattgtaacaaccacctggatgcttgcatggagctctccaaactgatgaaggacagccgctaccagcacttctttgaggcctgtcgcctcttgcagcagatgattgacattgctatcgatggtttccttttgactccagtgcagaagatctgcaagtatcccttacagttggctgagctcctaaagtatactgcccaagaccacagtgactacaggtatgtggcagctgctttggctgtcatgagaaatgtgactcagcagatcaacgaacgcaagcgacgtttagagaatattgacaagattgctcagtggcaggcttctgtcctagactgggagggcgaggacatcctagacaggagctcggagctgatctacactggggagatggcctggatctaccagccctacggccgcaaccagcagcgggtcttcttcctgtttgaccaccagatggtcctctgcaagaaggacctaatccggagagacatcctgtactacaaaggccgcattgacatggataaatatgaggtagttgacattgaggatggcagagatgatgacttcaatgtcagcatgaagaatgcctttaagcttcacaacaaggagactgaggagatacatctgttctttgccaagaagctggaggaaaaaatacgctggctcagggctttcagagaagagaggaaaatggtacaggaagatgaaaaaattggctttgaaatttctgaaaaccagaagaggcaggctgcaatgactgtgagaaaagtccctaagcaaaaaggtgtcaactctgcccgctcagttcctccttcctacccaccaccgcaggacccgttaaaccacggccagtacctggtccccgacggcatcgctcagtcgcaggtctttgagttcaccgaacccaagcgcagccagtcaccattctggcaaaacttcagcaggttaacccccttcaaaaaatga
Sequence Length
1551
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,458 Da
NCBI Official Full Name
Homo sapiens Cdc42 guanine nucleotide exchange factor (GEF) 9, mRNA
NCBI Official Synonym Full Names
Cdc42 guanine nucleotide exchange factor 9
NCBI Official Symbol
ARHGEF9
NCBI Official Synonym Symbols
PEM2; EIEE8; PEM-2; HPEM-2; COLLYBISTIN
NCBI Protein Information
rho guanine nucleotide exchange factor 9
UniProt Protein Name
Rho guanine nucleotide exchange factor 9
UniProt Gene Name
ARHGEF9
UniProt Synonym Gene Names
ARHDH9; KIAA0424
UniProt Entry Name
ARHG9_HUMAN
Similar Products
Product Notes
The ARHGEF9 arhgef9 (Catalog #AAA116425) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgttgc tgatcactgg agattccatc gttagtgctg aggcagtatg ggatcacgtc accatggcca accgggagtt ggcatttaaa gctggcgacg tcatcaaagt cttggatgct tccaacaagg attggtggtg gggccagatc gacgatgagg agggatggtt tcctgccagc tttgtgaggc tctgggtgaa ccaggaggat gaggtggagg aggggcccag cgatgtgcag aacggacacc tggaccccaa ttcagactgc ctctgtctgg ggcggccact acagaaccgg gaccagatgc gggccaatgt catcaatgag ataatgagca ctgagcgtca ctacatcaag cacctcaagg atatttgtga gggctatctg aagcagtgcc ggaagagaag ggacatgttc agtgacgagc aactgaaggt aatctttggg aacattgaag atatctacag atttcagatg ggctttgtga gagacctgga gaaacagtat aacaatgatg acccccacct cagcgagata ggaccctgct tcctagagca ccaagatgga ttctggatat actctgagta ttgtaacaac cacctggatg cttgcatgga gctctccaaa ctgatgaagg acagccgcta ccagcacttc tttgaggcct gtcgcctctt gcagcagatg attgacattg ctatcgatgg tttccttttg actccagtgc agaagatctg caagtatccc ttacagttgg ctgagctcct aaagtatact gcccaagacc acagtgacta caggtatgtg gcagctgctt tggctgtcat gagaaatgtg actcagcaga tcaacgaacg caagcgacgt ttagagaata ttgacaagat tgctcagtgg caggcttctg tcctagactg ggagggcgag gacatcctag acaggagctc ggagctgatc tacactgggg agatggcctg gatctaccag ccctacggcc gcaaccagca gcgggtcttc ttcctgtttg accaccagat ggtcctctgc aagaaggacc taatccggag agacatcctg tactacaaag gccgcattga catggataaa tatgaggtag ttgacattga ggatggcaga gatgatgact tcaatgtcag catgaagaat gcctttaagc ttcacaacaa ggagactgag gagatacatc tgttctttgc caagaagctg gaggaaaaaa tacgctggct cagggctttc agagaagaga ggaaaatggt acaggaagat gaaaaaattg gctttgaaat ttctgaaaac cagaagaggc aggctgcaat gactgtgaga aaagtcccta agcaaaaagg tgtcaactct gcccgctcag ttcctccttc ctacccacca ccgcaggacc cgttaaacca cggccagtac ctggtccccg acggcatcgc tcagtcgcag gtctttgagt tcaccgaacc caagcgcagc cagtcaccat tctggcaaaa cttcagcagg ttaaccccct tcaaaaaatg a. It is sometimes possible for the material contained within the vial of "ARHGEF9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.