ATG4A cdna clone
ATG4A cDNA Clone
Gene Names
ATG4A; APG4A; AUTL2
Synonyms
ATG4A; N/A; ATG4A cDNA Clone; ATG4A cdna clone
Sequence
atggagtcagttttatccaagtatgaagatcagattactattttcactgactacctagaagaatatccagatacagatgagctggtatggatcttagggaagcagcatctccttaaaacagaaaaatctaagctgttgtctgatataagtgctcgtctatggtttacatacagaaggaaattttcaccaattggtggaacgggcccttcatcagatgctggttggggatgtatgctacgctgtggacagatgatgctggctcaagcccttatctgtagacacttgggaagggactggagctgggagaaacaaaaagaacaacccaaagaataccaacgcatcctacagtgcttcttagatagaaaagattgttgctactctatccatcaaatggcacaaatgggtgtaggagaagggaaatcaattggagaatggtttggaccaaatacagttgcacaggtgttaaaaaaacttgctttatttgacgaatggaattccttggctgtttatgtttcaatggataacacagtggtcattgaagatatcaaaaaaatgtgccgtgtccttcccttgagtgctgacacagctggtgacaggcctcccgattctttaactgcttcaaaccagagtaagggcacctctgcctactgctcagcctggaaacccctgctgctcattgtgccccttcgcctgggcataaaccaaatcaatcctgtctatgttgatgcattcaaagagtgttttaagatgccacagtctttaggggcattaggaggaaaaccaaataacgcgtattatttcataggattcttaggtgacgagctcatcttcttggaccctcatacaacccagacctttgttgacactgaagagaatggaacggttaatgaccagactttccattgcctgcagtccccacagcgaatgaacatcctaaacctggatccttcagttgcattgggatttttctgcaaagaagaaaaagactttgataactggtgtagccttgttcagaaggaaattctaaaggagaatttaaggatgtttgaattagttcagaaacatccatcacactggcctccctttgtacctccagccaagccagaagtgacaaccactggggcagaattcattgactctactgagcaactggaggagtttgatctggaggaagattttgagattctgagtgtgtag
Sequence Length
1197
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,453 Da
NCBI Official Full Name
Homo sapiens ATG4 autophagy related 4 homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
autophagy related 4A cysteine peptidase
NCBI Official Symbol
ATG4A
NCBI Official Synonym Symbols
APG4A; AUTL2
NCBI Protein Information
cysteine protease ATG4A
UniProt Protein Name
Cysteine protease ATG4A
UniProt Gene Name
ATG4A
UniProt Synonym Gene Names
APG4A; AUTL2; hAPG4A
UniProt Entry Name
ATG4A_HUMAN
Similar Products
Product Notes
The ATG4A atg4a (Catalog #AAA116338) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtcag ttttatccaa gtatgaagat cagattacta ttttcactga ctacctagaa gaatatccag atacagatga gctggtatgg atcttaggga agcagcatct ccttaaaaca gaaaaatcta agctgttgtc tgatataagt gctcgtctat ggtttacata cagaaggaaa ttttcaccaa ttggtggaac gggcccttca tcagatgctg gttggggatg tatgctacgc tgtggacaga tgatgctggc tcaagccctt atctgtagac acttgggaag ggactggagc tgggagaaac aaaaagaaca acccaaagaa taccaacgca tcctacagtg cttcttagat agaaaagatt gttgctactc tatccatcaa atggcacaaa tgggtgtagg agaagggaaa tcaattggag aatggtttgg accaaataca gttgcacagg tgttaaaaaa acttgcttta tttgacgaat ggaattcctt ggctgtttat gtttcaatgg ataacacagt ggtcattgaa gatatcaaaa aaatgtgccg tgtccttccc ttgagtgctg acacagctgg tgacaggcct cccgattctt taactgcttc aaaccagagt aagggcacct ctgcctactg ctcagcctgg aaacccctgc tgctcattgt gccccttcgc ctgggcataa accaaatcaa tcctgtctat gttgatgcat tcaaagagtg ttttaagatg ccacagtctt taggggcatt aggaggaaaa ccaaataacg cgtattattt cataggattc ttaggtgacg agctcatctt cttggaccct catacaaccc agacctttgt tgacactgaa gagaatggaa cggttaatga ccagactttc cattgcctgc agtccccaca gcgaatgaac atcctaaacc tggatccttc agttgcattg ggatttttct gcaaagaaga aaaagacttt gataactggt gtagccttgt tcagaaggaa attctaaagg agaatttaag gatgtttgaa ttagttcaga aacatccatc acactggcct ccctttgtac ctccagccaa gccagaagtg acaaccactg gggcagaatt cattgactct actgagcaac tggaggagtt tgatctggag gaagattttg agattctgag tgtgtag. It is sometimes possible for the material contained within the vial of "ATG4A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.