Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

ATOH1 cdna clone

ATOH1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
ATOH1; ATH1; HATH1; MATH-1; bHLHa14
Synonyms
ATOH1; N/A; ATOH1 cDNA Clone; ATOH1 cdna clone
Ordering
Sequence
atgtcccgcctgctgcatgcagaagagtgggctgaagtgaaggagttgggagaccaccatcgccagccccagccgcatcatctcccgcaaccgccgccgccgccgcagccacctgcaactttgcaggcgagagagcatcccgtctacccgcctgagctgtccctcctggacagcaccgacccacgcgcctggctggctcccactttgcagggcatctgcacggcacgcgccgcccagtatttgctacattccccggagctgggtgcctcagaggccgctgcgccccgggacgaggtggacggccggggggagctggtaaggaggagcagcggcggtgccagcagcagcaagagccccgggccggtgaaagtgcgggaacagctgtgcaagctgaaaggcggggtggtggtagacgagctgggctgcagccgccaacgggccccttccagcaaacaggtgaatggggtgcagaagcagagacggctagcagccaacgccagggagcggcgcaggatgcatgggctgaaccacgccttcgaccagctgcgcaatgttatcccgtcgttcaacaacgacaagaagctgtccaaatatgagaccctgcagatggcccaaatctacatcaacgccttgtccgagctgctacaaacgcccagcggaggggaacagccaccgccgcctccagcctcctgcaaaagcgaccaccaccaccttcgcaccgcggcctcctatgaagggggcgcgggcaacgcgaccgcagctggggctcagcaggcttccggagggagccagcggccgaccccgcccgggagttgccggactcgcttctcagccccagcttctgcgggagggtactcggtgcagctggacgctctgcacttctcgactttcgaggacagcgccctgacagcgatgatggcgcaaaagaatttgtctccttctctccccgggagcatcttgcagccagtgcaggaggaaaacagcaaaacttcgcctcggtcccacagaagcgacggggaattttccccccattcccattacagtgactcggatgaggcaagttag
Sequence Length
1065
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
474
Molecular Weight
38,160 Da
NCBI Official Full Name
Homo sapiens atonal homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
atonal bHLH transcription factor 1
NCBI Official Symbol
ATOH1
NCBI Official Synonym Symbols
ATH1; HATH1; MATH-1; bHLHa14
NCBI Protein Information
protein atonal homolog 1
UniProt Protein Name
Protein atonal homolog 1
UniProt Gene Name
ATOH1
UniProt Synonym Gene Names
ATH1; BHLHA14; bHLHa14; hATH1
UniProt Entry Name
ATOH1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The ATOH1 atoh1 (Catalog #AAA116275) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccgcc tgctgcatgc agaagagtgg gctgaagtga aggagttggg agaccaccat cgccagcccc agccgcatca tctcccgcaa ccgccgccgc cgccgcagcc acctgcaact ttgcaggcga gagagcatcc cgtctacccg cctgagctgt ccctcctgga cagcaccgac ccacgcgcct ggctggctcc cactttgcag ggcatctgca cggcacgcgc cgcccagtat ttgctacatt ccccggagct gggtgcctca gaggccgctg cgccccggga cgaggtggac ggccgggggg agctggtaag gaggagcagc ggcggtgcca gcagcagcaa gagccccggg ccggtgaaag tgcgggaaca gctgtgcaag ctgaaaggcg gggtggtggt agacgagctg ggctgcagcc gccaacgggc cccttccagc aaacaggtga atggggtgca gaagcagaga cggctagcag ccaacgccag ggagcggcgc aggatgcatg ggctgaacca cgccttcgac cagctgcgca atgttatccc gtcgttcaac aacgacaaga agctgtccaa atatgagacc ctgcagatgg cccaaatcta catcaacgcc ttgtccgagc tgctacaaac gcccagcgga ggggaacagc caccgccgcc tccagcctcc tgcaaaagcg accaccacca ccttcgcacc gcggcctcct atgaaggggg cgcgggcaac gcgaccgcag ctggggctca gcaggcttcc ggagggagcc agcggccgac cccgcccggg agttgccgga ctcgcttctc agccccagct tctgcgggag ggtactcggt gcagctggac gctctgcact tctcgacttt cgaggacagc gccctgacag cgatgatggc gcaaaagaat ttgtctcctt ctctccccgg gagcatcttg cagccagtgc aggaggaaaa cagcaaaact tcgcctcggt cccacagaag cgacggggaa ttttcccccc attcccatta cagtgactcg gatgaggcaa gttag. It is sometimes possible for the material contained within the vial of "ATOH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.