Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

BCHE cdna clone

BCHE cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
BCHE; E1; CHE1
Synonyms
BCHE; N/A; BCHE cDNA Clone; E1; BCHE cdna clone
Ordering
Sequence
atgcatagcaaagtcacaatcatatgcatcagatttctcttttggtttcttttgctctgcatgcttattgggaagtcacatactgaagatgacatcataattgcaacaaagaatggaaaagtcagagggatgaacttgacagtttttggtggcacggtaacagcctttcttggaattccctatgcacagccacctcttggtagacttcgattcaaaaagccacagtctctgaccaagtggtctgatatttggaatgccacaaaatatgcaaattcttgctgtcagaacatagatcaaagttttccaggcttccatggatcagagatgtggaacccaaacactgacctcagtgaagactgtttatatctaaatgtatggattccagcacctaaaccaaaaaatgccactgtattgatatggatttatggtggtggttttcaaactggaacatcatctttacatgtttatgatggcaagtttctggctcgggttgaaagagttattgtagtgtcaatgaactatagggtgggtgccctaggattcttagctttgccaggaaatcctgaggctccagggaacatgggtttatttgatcaacagttggctcttcagtgggttcaaaaaaatatagcagcctttggtggaaatcctaaaagtgtaactctctttggagaaagtgcaggagcagcttcagttagcctgcatttgctttctcctggaagccattcattgttcaccagagccattctgcaaagtggatcctttaatgctccttgggcggtaacatctctttatgaagctaggaacagaacgttgaacttagctaaattgactggttgctctagagagaatgagactgaaataatcaagtgtcttagaaataaagatccccaagaaattcttctgaatgaagcatttgttgtcccctatgggactcctttgtcagtaaactttggtccgaccgtggatggtgattttctcactgacatgccagacatattacttgaacttggacaatttaaaaaaacccagattttggtgggtgttaataaagatgaagggacagcttttttagtctatggtgctcctggcttcagcaaagataacaatagtatcataactagaaaagaatttcaggaaggtttaaaaatattttttccaggagtgagtgagtttggaaaggaatccatcctttttcattacacagactgggtagatgatcagagacctgaaaactaccgtgaggccttgggtgatgttgttggggattataatttcatatgccctgccttggagttcaccaagaagttctcagaatggggaaataatgcctttttctactattttgaacaccgatcctccaaacttccgtggccagaatggatgggagtgatgcatggctatgaaattgaatttgtctttggtttacctctggaaagaagagataattacacaaaagccgaggaaattttgagtagatccatagtgaaacggtgggcaaattttgcaaaatatgggaatccaaatgagactcagaacaatagcacaagctggcctgtcttcaaaagcactgaacaaaaatatctaaccttgaatacagagtcaacaagaataatgacgaaactacgtgctcaacaatgtcgattctggacatcattttttccaaaagtcttggaaatgacaggaaatattgatgaagcagaatgggagtggaaagcaggattccatcgctggaacaattacatgatggactggaaaaatcaatttaacgattacactagcaagaaagaaagttgtgtgggtctctaa
Sequence Length
1809
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Related Product Information for BCHE cdna clone
Homo sapiens butyrylcholinesterase, mRNA complete cds.

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
590
UniProt Accession #
Molecular Weight
68,418 Da
NCBI Official Full Name
Homo sapiens butyrylcholinesterase, mRNA
NCBI Official Synonym Full Names
butyrylcholinesterase
NCBI Official Symbol
BCHE
NCBI Official Synonym Symbols
E1; CHE1
NCBI Protein Information
cholinesterase; cholinesterase 1; choline esterase II; pseudocholinesterase; butyrylcholine esterase; acylcholine acylhydrolase
UniProt Protein Name
Cholinesterase
UniProt Gene Name
BCHE
UniProt Synonym Gene Names
CHE1
UniProt Entry Name
CHLE_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The BCHE bche (Catalog #AAA116323) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatagca aagtcacaat catatgcatc agatttctct tttggtttct tttgctctgc atgcttattg ggaagtcaca tactgaagat gacatcataa ttgcaacaaa gaatggaaaa gtcagaggga tgaacttgac agtttttggt ggcacggtaa cagcctttct tggaattccc tatgcacagc cacctcttgg tagacttcga ttcaaaaagc cacagtctct gaccaagtgg tctgatattt ggaatgccac aaaatatgca aattcttgct gtcagaacat agatcaaagt tttccaggct tccatggatc agagatgtgg aacccaaaca ctgacctcag tgaagactgt ttatatctaa atgtatggat tccagcacct aaaccaaaaa atgccactgt attgatatgg atttatggtg gtggttttca aactggaaca tcatctttac atgtttatga tggcaagttt ctggctcggg ttgaaagagt tattgtagtg tcaatgaact atagggtggg tgccctagga ttcttagctt tgccaggaaa tcctgaggct ccagggaaca tgggtttatt tgatcaacag ttggctcttc agtgggttca aaaaaatata gcagcctttg gtggaaatcc taaaagtgta actctctttg gagaaagtgc aggagcagct tcagttagcc tgcatttgct ttctcctgga agccattcat tgttcaccag agccattctg caaagtggat cctttaatgc tccttgggcg gtaacatctc tttatgaagc taggaacaga acgttgaact tagctaaatt gactggttgc tctagagaga atgagactga aataatcaag tgtcttagaa ataaagatcc ccaagaaatt cttctgaatg aagcatttgt tgtcccctat gggactcctt tgtcagtaaa ctttggtccg accgtggatg gtgattttct cactgacatg ccagacatat tacttgaact tggacaattt aaaaaaaccc agattttggt gggtgttaat aaagatgaag ggacagcttt tttagtctat ggtgctcctg gcttcagcaa agataacaat agtatcataa ctagaaaaga atttcaggaa ggtttaaaaa tattttttcc aggagtgagt gagtttggaa aggaatccat cctttttcat tacacagact gggtagatga tcagagacct gaaaactacc gtgaggcctt gggtgatgtt gttggggatt ataatttcat atgccctgcc ttggagttca ccaagaagtt ctcagaatgg ggaaataatg cctttttcta ctattttgaa caccgatcct ccaaacttcc gtggccagaa tggatgggag tgatgcatgg ctatgaaatt gaatttgtct ttggtttacc tctggaaaga agagataatt acacaaaagc cgaggaaatt ttgagtagat ccatagtgaa acggtgggca aattttgcaa aatatgggaa tccaaatgag actcagaaca atagcacaag ctggcctgtc ttcaaaagca ctgaacaaaa atatctaacc ttgaatacag agtcaacaag aataatgacg aaactacgtg ctcaacaatg tcgattctgg acatcatttt ttccaaaagt cttggaaatg acaggaaata ttgatgaagc agaatgggag tggaaagcag gattccatcg ctggaacaat tacatgatgg actggaaaaa tcaatttaac gattacacta gcaagaaaga aagttgtgtg ggtctctaa. It is sometimes possible for the material contained within the vial of "BCHE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.