CAV2 cdna clone
CAV2 cDNA Clone
Gene Names
CAV2; CAV
Synonyms
CAV2; N/A; CAV2 cDNA Clone; CAV2 cdna clone
Sequence
atggggctggagacggagaaggcggacgtacagctcttcatggacgacgactcctacagccaccacagcggcctcgagtacgccgaccccgagaagttcgcggactcggaccaggaccgggatccccaccggctcaactcgcatctcaagctgggcttcgaggatgtgatcgcagagccggtgactacgcactcctttgacaaagtgtggatctgcagccatgccctctttgaaatcagcaaatacgtaatgtacaagttcctgacggtgttcctggccattcccctggccttcattgcgggaattctctttgccaccctcagctgtctgcacatctggattttaatgccttttgtaaagacctgcctaatggttctgccttcagtgcagacaatatggaagagtgtgacagatgttatcattgctccattgtgtacgagcgtaggacgatgcttctcttctgtcagcctgcaactgagccaggattga
Sequence Length
489
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
12,780 Da
NCBI Official Full Name
Homo sapiens caveolin 2, mRNA
NCBI Official Synonym Full Names
caveolin 2
NCBI Official Symbol
CAV2
NCBI Official Synonym Symbols
CAV
NCBI Protein Information
caveolin-2
UniProt Protein Name
Caveolin-2
UniProt Gene Name
CAV2
UniProt Entry Name
CAV2_HUMAN
Similar Products
Product Notes
The CAV2 cav2 (Catalog #AAA116310) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggctgg agacggagaa ggcggacgta cagctcttca tggacgacga ctcctacagc caccacagcg gcctcgagta cgccgacccc gagaagttcg cggactcgga ccaggaccgg gatccccacc ggctcaactc gcatctcaag ctgggcttcg aggatgtgat cgcagagccg gtgactacgc actcctttga caaagtgtgg atctgcagcc atgccctctt tgaaatcagc aaatacgtaa tgtacaagtt cctgacggtg ttcctggcca ttcccctggc cttcattgcg ggaattctct ttgccaccct cagctgtctg cacatctgga ttttaatgcc ttttgtaaag acctgcctaa tggttctgcc ttcagtgcag acaatatgga agagtgtgac agatgttatc attgctccat tgtgtacgag cgtaggacga tgcttctctt ctgtcagcct gcaactgagc caggattga. It is sometimes possible for the material contained within the vial of "CAV2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.