Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

CSF1 cdna clone

CSF1 cDNA Clone

Gene Names
CSF1; MCSF; CSF-1
Synonyms
CSF1; N/A; CSF1 cDNA Clone; CSF1 cdna clone
Ordering
Sequence
atgaccgcgccgggcgccgccgggcgctgccctcccacgacatggctgggctccctgctgttgttggtctgtctcctggcgagcaggagtatcaccgaggaggtgtcggagtactgtagccacatgattgggagtggacacctgcagtctctgcagcggctgattgacagtcagatggagacctcgtgccaaattacatttgagtttgtagaccaggaacagttgaaagatccagtgtgctaccttaagaaggcatttctcctggtacaagacataatggaggacaccatgcgcttcagagataacacccccaatgccatcgccattgtgcagctgcaggaactctctttgaggctgaagagctgcttcaccaaggattatgaagagcatgacaaggcctgcgtccgaactttctatgagacacctctccagttgctggagaaggtcaagaatgtctttaatgaaacaaagaatctccttgacaaggactggaatattttcagcaagaactgcaacaacagctttgctgaatgctccagccaagatgtggtgaccaagcctgattgcaactgcctgtaccccaaagccatccctagcagtgacccggcctctgtctcccctcatcagcccctcgccccctccatggcccctgtggctggcttgacctgggaggactctgagggaactgagggcagctccctcttgcctggtgagcagcccctgcacacagtggatccaggcagtgccaagcagcggccacccaggagcacctgccagagctttgagccgccagagaccccagttgtcaaggacagcaccatcggtggctcaccacagcctcgcccctctgtcggggccttcaaccccgggatggaggatattcttgactctgcaatgggcactaattgggtcccagaagaagcctctggagaggccagtgagattcccgtaccccaagggacagagctttccccctccaggccaggagggggcagcatgcagacagagcccgccagacccagcaacttcctctcagcatcttctccactccctgcatcagcaaagggccaacagccggcagatgtaactggtacagccttgcccagggtgggccccgtgaggcccactggccaggactggaatcacaccccccagaagacagaccatccatctgccctgctcagagaccccccggagccaggctctcccaggatctcatcactgcgcccccagggcctcagcaacccctccaccctctctgctcagccacagctttccagaagccactcctcgggcagcgtgctgccccttggggagctggagggcaggaggagcaccagggatcggaggagccccgcagagccagaaggaggaccagcaagtgaaggggcagccaggcccctgccccgttttaactccgttcctttgactgacacaggccatgagaggcagtccgagggatcctccagcccgcagctccaggagtctgtcttccacctgctggtgcccagtgtcatcctggtcttgctggccgtcggaggcctcttgttctacaggtggaggcggcggagccatcaagagcctcagagagcggattctcccttggagcaaccagagggcagccccctgactcaggatgacagacaggtggaactgccagtgtag
Sequence Length
1665
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,215 Da
NCBI Official Full Name
Homo sapiens colony stimulating factor 1 (macrophage), mRNA
NCBI Official Synonym Full Names
colony stimulating factor 1
NCBI Official Symbol
CSF1
NCBI Official Synonym Symbols
MCSF; CSF-1
NCBI Protein Information
macrophage colony-stimulating factor 1
UniProt Protein Name
Macrophage colony-stimulating factor 1
UniProt Gene Name
CSF1
UniProt Synonym Gene Names
CSF-1; M-CSF; MCSF
UniProt Entry Name
CSF1_HUMAN

Similar Products

Product Notes

The CSF1 csf1 (Catalog #AAA116261) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgcgc cgggcgccgc cgggcgctgc cctcccacga catggctggg ctccctgctg ttgttggtct gtctcctggc gagcaggagt atcaccgagg aggtgtcgga gtactgtagc cacatgattg ggagtggaca cctgcagtct ctgcagcggc tgattgacag tcagatggag acctcgtgcc aaattacatt tgagtttgta gaccaggaac agttgaaaga tccagtgtgc taccttaaga aggcatttct cctggtacaa gacataatgg aggacaccat gcgcttcaga gataacaccc ccaatgccat cgccattgtg cagctgcagg aactctcttt gaggctgaag agctgcttca ccaaggatta tgaagagcat gacaaggcct gcgtccgaac tttctatgag acacctctcc agttgctgga gaaggtcaag aatgtcttta atgaaacaaa gaatctcctt gacaaggact ggaatatttt cagcaagaac tgcaacaaca gctttgctga atgctccagc caagatgtgg tgaccaagcc tgattgcaac tgcctgtacc ccaaagccat ccctagcagt gacccggcct ctgtctcccc tcatcagccc ctcgccccct ccatggcccc tgtggctggc ttgacctggg aggactctga gggaactgag ggcagctccc tcttgcctgg tgagcagccc ctgcacacag tggatccagg cagtgccaag cagcggccac ccaggagcac ctgccagagc tttgagccgc cagagacccc agttgtcaag gacagcacca tcggtggctc accacagcct cgcccctctg tcggggcctt caaccccggg atggaggata ttcttgactc tgcaatgggc actaattggg tcccagaaga agcctctgga gaggccagtg agattcccgt accccaaggg acagagcttt ccccctccag gccaggaggg ggcagcatgc agacagagcc cgccagaccc agcaacttcc tctcagcatc ttctccactc cctgcatcag caaagggcca acagccggca gatgtaactg gtacagcctt gcccagggtg ggccccgtga ggcccactgg ccaggactgg aatcacaccc cccagaagac agaccatcca tctgccctgc tcagagaccc cccggagcca ggctctccca ggatctcatc actgcgcccc cagggcctca gcaacccctc caccctctct gctcagccac agctttccag aagccactcc tcgggcagcg tgctgcccct tggggagctg gagggcagga ggagcaccag ggatcggagg agccccgcag agccagaagg aggaccagca agtgaagggg cagccaggcc cctgccccgt tttaactccg ttcctttgac tgacacaggc catgagaggc agtccgaggg atcctccagc ccgcagctcc aggagtctgt cttccacctg ctggtgccca gtgtcatcct ggtcttgctg gccgtcggag gcctcttgtt ctacaggtgg aggcggcgga gccatcaaga gcctcagaga gcggattctc ccttggagca accagagggc agccccctga ctcaggatga cagacaggtg gaactgccag tgtag. It is sometimes possible for the material contained within the vial of "CSF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.