Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

DOCK10 cdna clone

DOCK10 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
DOCK10; ZIZ3; DRIP2; Nbla10300
Synonyms
DOCK10; N/A; DOCK10 cDNA Clone; DOCK10 cdna clone
Ordering
Sequence
atgaaaaacagcaatttcccagcagaggtgaaggacctgactaagcgtataaggactgttttgatggccacagctcagatgaaggagcacgagaaggaccccgagatgctggtggatctccagtacagcctggcaaactcctacgcaagcactcctgaactacgcaggacctggctggaaagtatggccaagattcatgccagaaacggagatttatctgaggctgccatgtgttacatccatattgctgctctcattgcagagtatctgaaaagaaagggttactggaaagtggaaaagatttgcacagcatccctgctctcggaggatacccacccctgtgatagcaactcattactaacaactcccagtggaggaagcatgttctctatgggatggccagcttttttgagcattacaccaaacattaaggaagaaggagcgatgaaagaggattctggaatgcaagatacaccatacaatgagaatatcctggtggagcagctatacatgtgtgtggagtttctctggaagtctgagcgatatgaactcattgctgatgtcaacaagcccatcattgctgtctttgagaaacaacgagacttcaaaaaattgtcagatctctactacgacattcatcggtcatatctgaaagtggcagaggtggtgaattcggagaagcggctgtttggtcgctactatcgtgtggcattttatgggcagggcttttttgaagaagaagaaggtaaagagtatatttataaagagcctaagctgacaggtctgtccgagatttcccaaagattactcaagctctatgcagataaatttggagcagacaatgtgaagataatccaggattccaacaaggtaaaccccaaggatttggaccccaaatatgcctacatccaggtgacctatgtgacgccgttctttgaggaaaaggaaatcgaagaccggaagacagatttcgaaatgcaccacaacatcaaccgctttgtcttcgagacacccttcacgctgtcgggcaagaagcacggtggggtggcggagcagtgcaagcggcggacgatcctgacaacgagtcacctgttcccctacgtgaagaagagaatacaagtaattagccaatcgagcacagaactgaatccaattgaagtggcaattgacgagatgtccaagaaggtttctgagcttaatcagctttgcacaatggaagaagtggacatgatcagactgcagctcaaactgcaaggaagtgtcagcgtgaaggttaatgctgggccaatggcctatgcacgagcttttcttgaagaaaccaatgcaaagaagtaccctgacaaccaagtaaagcttttgaaggagatcttcaggcaatttgcagatgcatgtgggcaggcccttgacgtgaatgagcgcctcatcaaagaggaccagctggagtaccaggaagaactgaggtcccactacaaggacatgctcagcgaactctccacagtcatgaatgagcagattacgggcagggacgacctgtcaaagcgcggagtggaccaaacctgcactcgagtaattagcaaagcaactccggccctacccacggtctccatctcatctagtgctgaagtctga
Sequence Length
1629
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
249,491 Da
NCBI Official Full Name
Homo sapiens dedicator of cytokinesis 10, mRNA
NCBI Official Synonym Full Names
dedicator of cytokinesis 10
NCBI Official Symbol
DOCK10
NCBI Official Synonym Symbols
ZIZ3; DRIP2; Nbla10300
NCBI Protein Information
dedicator of cytokinesis protein 10
UniProt Protein Name
Dedicator of cytokinesis protein 10
UniProt Gene Name
DOCK10
UniProt Synonym Gene Names
KIAA0694; ZIZ3
UniProt Entry Name
DOC10_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The DOCK10 dock10 (Catalog #AAA116321) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaaaca gcaatttccc agcagaggtg aaggacctga ctaagcgtat aaggactgtt ttgatggcca cagctcagat gaaggagcac gagaaggacc ccgagatgct ggtggatctc cagtacagcc tggcaaactc ctacgcaagc actcctgaac tacgcaggac ctggctggaa agtatggcca agattcatgc cagaaacgga gatttatctg aggctgccat gtgttacatc catattgctg ctctcattgc agagtatctg aaaagaaagg gttactggaa agtggaaaag atttgcacag catccctgct ctcggaggat acccacccct gtgatagcaa ctcattacta acaactccca gtggaggaag catgttctct atgggatggc cagctttttt gagcattaca ccaaacatta aggaagaagg agcgatgaaa gaggattctg gaatgcaaga tacaccatac aatgagaata tcctggtgga gcagctatac atgtgtgtgg agtttctctg gaagtctgag cgatatgaac tcattgctga tgtcaacaag cccatcattg ctgtctttga gaaacaacga gacttcaaaa aattgtcaga tctctactac gacattcatc ggtcatatct gaaagtggca gaggtggtga attcggagaa gcggctgttt ggtcgctact atcgtgtggc attttatggg cagggctttt ttgaagaaga agaaggtaaa gagtatattt ataaagagcc taagctgaca ggtctgtccg agatttccca aagattactc aagctctatg cagataaatt tggagcagac aatgtgaaga taatccagga ttccaacaag gtaaacccca aggatttgga ccccaaatat gcctacatcc aggtgaccta tgtgacgccg ttctttgagg aaaaggaaat cgaagaccgg aagacagatt tcgaaatgca ccacaacatc aaccgctttg tcttcgagac acccttcacg ctgtcgggca agaagcacgg tggggtggcg gagcagtgca agcggcggac gatcctgaca acgagtcacc tgttccccta cgtgaagaag agaatacaag taattagcca atcgagcaca gaactgaatc caattgaagt ggcaattgac gagatgtcca agaaggtttc tgagcttaat cagctttgca caatggaaga agtggacatg atcagactgc agctcaaact gcaaggaagt gtcagcgtga aggttaatgc tgggccaatg gcctatgcac gagcttttct tgaagaaacc aatgcaaaga agtaccctga caaccaagta aagcttttga aggagatctt caggcaattt gcagatgcat gtgggcaggc ccttgacgtg aatgagcgcc tcatcaaaga ggaccagctg gagtaccagg aagaactgag gtcccactac aaggacatgc tcagcgaact ctccacagtc atgaatgagc agattacggg cagggacgac ctgtcaaagc gcggagtgga ccaaacctgc actcgagtaa ttagcaaagc aactccggcc ctacccacgg tctccatctc atctagtgct gaagtctga. It is sometimes possible for the material contained within the vial of "DOCK10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.