Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

ENO2 cdna clone

ENO2 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
ENO2; NSE; HEL-S-279
Synonyms
ENO2; N/A; ENO2 cDNA Clone; ENO2 cdna clone
Ordering
Sequence
atgtccatagagaagatctgggcccgggagatcctggactcccgcgggaaccccacagtggaggtggatctctatactgccaaaggtcttttccgggctgcagtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggagacaaacagcgttacttaggcaaaggtgtcctgaaggcagtggaccacatcaactccaccatcgcgccagccctcatcagctcaggtctctctgtggtggagcaagagaaactggacaacctgatgctggagttggatgggactgagaacaaatccaagtttggggccaatgccatcctgggtgtgtctctggccgtgtgtaaggcaggggcagctgagcgggaactgcccctgtatcgccacattgctcagctggccgggaactcagacctcatcctgcctgtgccggccttcaacgtgatcaatggtggctctcatgctggcaacaagctggccatgcaggagttcatgatcctcccagtgggagctgagagctttcgggatgccatgcgactaggtgcagaggtctaccatacactcaagggagtcatcaaggacaaatacggcaaggatgccaccaatgtgggggatgaaggtggctttgcccccaatatcctggagaacagtgaagccttggagctggtgaaggaagccatcgacaaggctggctacacggaaaagatcgttattggcatggatgttgctgcctcagagttttatcgtgatggcaaatatgacttggacttcaagtctcccactgatccttcccgatacatcactggggaccagctgggggcactctaccaggactttgtcagggactatcctgtggtctccattgaggacccatttgaccaggatgattgggctgcctggtccaagttcacagccaatgtagggatccagattgtgggtgatgacctgacagtgaccaacccaaaacgtattgagcgggcagtggaagaaaaggcctgcaactgtctgctgctcaaggtcaaccagatcggctctgtcactgaagccatccaagcgtgcaagctggcccaggagaatggctggggggtcatggtgagtcatcgctcaggagagactgaggacacattcattgctgacctggtggtggggctgtgcacaggccagatcaagactggtgccccgtgccgttctgaacgtctggctaaatacaaccagctcatgagaattgaggaagagctgggggatgaagctcgctttgccggacataacttccgtaatcccagtgtgctgtga
Sequence Length
1305
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,707 Da
NCBI Official Full Name
Homo sapiens enolase 2 (gamma, neuronal), mRNA
NCBI Official Synonym Full Names
enolase 2
NCBI Official Symbol
ENO2
NCBI Official Synonym Symbols
NSE; HEL-S-279
NCBI Protein Information
gamma-enolase
UniProt Protein Name
Gamma-enolase
UniProt Gene Name
ENO2
UniProt Synonym Gene Names
NSE
UniProt Entry Name
ENOG_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The ENO2 eno2 (Catalog #AAA116290) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccatag agaagatctg ggcccgggag atcctggact cccgcgggaa ccccacagtg gaggtggatc tctatactgc caaaggtctt ttccgggctg cagtgcccag tggagcctct acgggcatct atgaggccct ggagctgagg gatggagaca aacagcgtta cttaggcaaa ggtgtcctga aggcagtgga ccacatcaac tccaccatcg cgccagccct catcagctca ggtctctctg tggtggagca agagaaactg gacaacctga tgctggagtt ggatgggact gagaacaaat ccaagtttgg ggccaatgcc atcctgggtg tgtctctggc cgtgtgtaag gcaggggcag ctgagcggga actgcccctg tatcgccaca ttgctcagct ggccgggaac tcagacctca tcctgcctgt gccggccttc aacgtgatca atggtggctc tcatgctggc aacaagctgg ccatgcagga gttcatgatc ctcccagtgg gagctgagag ctttcgggat gccatgcgac taggtgcaga ggtctaccat acactcaagg gagtcatcaa ggacaaatac ggcaaggatg ccaccaatgt gggggatgaa ggtggctttg cccccaatat cctggagaac agtgaagcct tggagctggt gaaggaagcc atcgacaagg ctggctacac ggaaaagatc gttattggca tggatgttgc tgcctcagag ttttatcgtg atggcaaata tgacttggac ttcaagtctc ccactgatcc ttcccgatac atcactgggg accagctggg ggcactctac caggactttg tcagggacta tcctgtggtc tccattgagg acccatttga ccaggatgat tgggctgcct ggtccaagtt cacagccaat gtagggatcc agattgtggg tgatgacctg acagtgacca acccaaaacg tattgagcgg gcagtggaag aaaaggcctg caactgtctg ctgctcaagg tcaaccagat cggctctgtc actgaagcca tccaagcgtg caagctggcc caggagaatg gctggggggt catggtgagt catcgctcag gagagactga ggacacattc attgctgacc tggtggtggg gctgtgcaca ggccagatca agactggtgc cccgtgccgt tctgaacgtc tggctaaata caaccagctc atgagaattg aggaagagct gggggatgaa gctcgctttg ccggacataa cttccgtaat cccagtgtgc tgtga. It is sometimes possible for the material contained within the vial of "ENO2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.