Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

GNPTAB cdna clone

GNPTAB cDNA Clone

Gene Names
GNPTAB; ICD; GNPTA
Synonyms
GNPTAB; N/A; GNPTAB cDNA Clone; GNPTAB cdna clone
Ordering
Sequence
atgctgttcaagctcctacagagacagacctatacctgcctgtcccacaggtatgggctctacgtgtgcttcttgggcgtcgttgtcaccatcgtctccgccttccagttcggagaggtggttctggaatggagccgagatcaataccatgttttgtttgattcctatagagacaatattgctggaaagtcctttcagaatcggtctgtgaggtaa
Sequence Length
216
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
143,622 Da
NCBI Official Full Name
Homo sapiens N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits, mRNA
NCBI Official Synonym Full Names
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
NCBI Official Symbol
GNPTAB
NCBI Official Synonym Symbols
ICD; GNPTA
NCBI Protein Information
N-acetylglucosamine-1-phosphotransferase subunits alpha/beta; stealth protein GNPTAB; GlcNAc phosphotransferase; glcNAc-1-phosphotransferase subunits alpha/beta; UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosamine; UDP-N-acetylglucosamine-1-phosphotransferase subunits alpha/beta; glucosamine (UDP-N-acetyl)-lysosomal-enzyme N-acetylglucosamine phosphotransferase
UniProt Protein Name
N-acetylglucosamine-1-phosphotransferase subunits alpha/beta
UniProt Gene Name
GNPTAB
UniProt Synonym Gene Names
GNPTA; KIAA1208
UniProt Entry Name
GNPTA_HUMAN

Similar Products

Product Notes

The GNPTAB gnptab (Catalog #AAA116449) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgttca agctcctaca gagacagacc tatacctgcc tgtcccacag gtatgggctc tacgtgtgct tcttgggcgt cgttgtcacc atcgtctccg ccttccagtt cggagaggtg gttctggaat ggagccgaga tcaataccat gttttgtttg attcctatag agacaatatt gctggaaagt cctttcagaa tcggtctgtg aggtaa. It is sometimes possible for the material contained within the vial of "GNPTAB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.