IGHG1 cdna clone
IGHG1 cDNA Clone
Synonyms
IGHG1; N/A; IGHG1 cDNA Clone; IGHG1 cdna clone
Sequence
atgaaatttgggctgagctggattttccttcctgctatattaaaaggtgtccagtgtgaggtgcagctggtggagtctgggggaggcttggtaaaggcgggggggtccctaagactctcctgtgcagcctctggattcagtttcagtgatgcctggatgagctgggcccgccagcctccagggaaggggctggagtggcttggccgcattaaaaggaaaagtgatggtgggacaacagagtacgctgcacacgtgaaaggcagattcatcatctctagagacgactcaaaatacatggtgtatatgcagatgaacagtctgaagaccgaggacacggccgtctattactgtaatacagatgcccgctcagtaggatccttggagtggcccaattattatcacggtatgaacgtctggggtgaagggaccacggtcaccgtctcttcagcctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacccagacctacatctgcaacgtgaatcacaagcccagcaacaccaaggtggacaagaaagttgagcccaaatcttgtgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga
Sequence Length
1440
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Related Product Information for IGHG1 cdna clone
Homo sapiens immunoglobulin heavy constant gamma 1 (G1m marker), mRNA (cDNA clone IMAGE:4850078)
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
36,106 Da
NCBI Official Full Name
Homo sapiens immunoglobulin heavy constant gamma 1 (G1m marker), mRNA
NCBI Official Synonym Full Names
immunoglobulin heavy constant gamma 1 (G1m marker)
NCBI Official Symbol
IGHG1
UniProt Protein Name
Ig gamma-1 chain C region
UniProt Gene Name
IGHG1
UniProt Entry Name
IGHG1_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The IGHG1 ighg1 (Catalog #AAA116402) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaatttg ggctgagctg gattttcctt cctgctatat taaaaggtgt ccagtgtgag gtgcagctgg tggagtctgg gggaggcttg gtaaaggcgg gggggtccct aagactctcc tgtgcagcct ctggattcag tttcagtgat gcctggatga gctgggcccg ccagcctcca gggaaggggc tggagtggct tggccgcatt aaaaggaaaa gtgatggtgg gacaacagag tacgctgcac acgtgaaagg cagattcatc atctctagag acgactcaaa atacatggtg tatatgcaga tgaacagtct gaagaccgag gacacggccg tctattactg taatacagat gcccgctcag taggatcctt ggagtggccc aattattatc acggtatgaa cgtctggggt gaagggacca cggtcaccgt ctcttcagcc tccaccaagg gcccatcggt cttccccctg gcaccctcct ccaagagcac ctctgggggc acagcggccc tgggctgcct ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg aactcaggcg ccctgaccag cggcgtgcac accttcccgg ctgtcctaca gtcctcagga ctctactccc tcagcagcgt ggtgaccgtg ccctccagca gcttgggcac ccagacctac atctgcaacg tgaatcacaa gcccagcaac accaaggtgg acaagaaagt tgagcccaaa tcttgtgaca aaactcacac atgcccaccg tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa tggcaaggag tacaagtgca aggtctccaa caaagccctc ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg tacaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gacctgcctg gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacgcag aagagcctct ccctgtctcc gggtaaatga. It is sometimes possible for the material contained within the vial of "IGHG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.