Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

MAS1 cdna clone

MAS1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
MAS1; MAS
Synonyms
MAS1; N/A; MAS1 cDNA Clone; MAS1 cdna clone
Ordering
Sequence
atggatgggtcaaacgtgacatcatttgttgttgaggaacccacgaacatctcaactggcaggaacgcctcagtcgggaatgcacatcggcaaatccccatcgtgcactgggtcattatgagcatctccccagtggggtttgttgagaatgggattctcctctggttcctgtgcttccggatgagaagaaatcccttcactgtctacatcacccacctgtctatcgcagacatctcactgctcttctgtattttcatcttgtctatcgactatgctttagattatgagctttcttctggccattactacacaattgtcacattatcagtgacttttctgtttggctacaacacgggcctctatctgctgacggccattagtgtggagaggtgcctgtcagtcctttaccccatctggtaccgatgccatcgccccaagtaccagtcggcattggtctgtgcccttctgtgggctctttcttgcttggtgaccaccatggagtatgtcatgtgcatcgacagagaagaagagagtcactctcggaatgactgccgagcagtcatcatctttatagccatcctgagcttcctggtcttcacgcccctcatgctggtgtccagcaccatcttggtcgtgaagatccggaagaacacgtgggcttcccattcctccaagctttacatagtcatcatggtcaccatcattatattcctcatcttcgctatgcccatgagactcctttacctgctgtactatgagtattggtcgacctttgggaacctacaccacatttccctgctcttctccacaatcaacagtagcgccaaccctttcatttacttctttgtgggaagcagtaagaagaagagattcaaggagtccttaaaagttgttctgaccagggctttcaaagatgaaatgcaacctcggcgccagaaagacaattgtaatacggtcacagttgagactgtcgtctaa
Sequence Length
978
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
37,465 Da
NCBI Official Full Name
Homo sapiens MAS1 oncogene, mRNA
NCBI Official Synonym Full Names
MAS1 oncogene
NCBI Official Symbol
MAS1
NCBI Official Synonym Symbols
MAS
NCBI Protein Information
proto-oncogene Mas
UniProt Protein Name
Proto-oncogene Mas
UniProt Gene Name
MAS1
UniProt Synonym Gene Names
MAS
UniProt Entry Name
MAS_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The MAS1 mas1 (Catalog #AAA116253) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgggt caaacgtgac atcatttgtt gttgaggaac ccacgaacat ctcaactggc aggaacgcct cagtcgggaa tgcacatcgg caaatcccca tcgtgcactg ggtcattatg agcatctccc cagtggggtt tgttgagaat gggattctcc tctggttcct gtgcttccgg atgagaagaa atcccttcac tgtctacatc acccacctgt ctatcgcaga catctcactg ctcttctgta ttttcatctt gtctatcgac tatgctttag attatgagct ttcttctggc cattactaca caattgtcac attatcagtg acttttctgt ttggctacaa cacgggcctc tatctgctga cggccattag tgtggagagg tgcctgtcag tcctttaccc catctggtac cgatgccatc gccccaagta ccagtcggca ttggtctgtg cccttctgtg ggctctttct tgcttggtga ccaccatgga gtatgtcatg tgcatcgaca gagaagaaga gagtcactct cggaatgact gccgagcagt catcatcttt atagccatcc tgagcttcct ggtcttcacg cccctcatgc tggtgtccag caccatcttg gtcgtgaaga tccggaagaa cacgtgggct tcccattcct ccaagcttta catagtcatc atggtcacca tcattatatt cctcatcttc gctatgccca tgagactcct ttacctgctg tactatgagt attggtcgac ctttgggaac ctacaccaca tttccctgct cttctccaca atcaacagta gcgccaaccc tttcatttac ttctttgtgg gaagcagtaa gaagaagaga ttcaaggagt ccttaaaagt tgttctgacc agggctttca aagatgaaat gcaacctcgg cgccagaaag acaattgtaa tacggtcaca gttgagactg tcgtctaa. It is sometimes possible for the material contained within the vial of "MAS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.