NAMPT cdna clone
NAMPT cDNA Clone
Gene Names
NAMPT; VF; PBEF; PBEF1; VISFATIN; 1110035O14Rik
Synonyms
NAMPT; N/A; NAMPT cDNA Clone; NAMPT cdna clone
Sequence
atgaatcctgcggcagaagccgagttcaacatcctcctggccaccgactcctacaaggttactcactataaacaatatccacccaacacaagcaaagtttattcctactttgaatgccgtgaaaagaagacagaaaactccaaattaaggaaggtgaaatatgaggaaacagtattttatgggttgcagtacattcttaataagtacttaaaaggtaaagtagtaaccaaagagaaaatccaggaagccaaagatgtctacaaagaacatttccaagatgatgtctttaatgaaaagggatggaactacattcttgagaagtatgatgggcatcttccaatagaaataaaagctgttcctgagggctttgtcattcccagaggaaatgttctcttcacggtggaaaacacagatccagagtgttactggcttacaaattggattgagactattcttgttcagtcctggtatccaatcacagtggccacaaattctagagagcagaagaaaatattggccaaatatttgttagaaacttctggtaacttagatggtctggaatacaagttacatgattttggctacagaggagtctcttcccaagagactgctggcataggagcatctgctcacttggttaacttcaaaggaacagatacagtagcaggacttgctctaattaaaaaatattatggaacgaaagatcctgttccaggctattctgttccagcagcagaacacagtaccataacagcttgggggaaagaccatgaaaaagatgcttttgaacatattgtaacacagttttcatcagtgcctgtatctgtggtcagcgatagctatgacatttataatgcgtgtgagaaaatatggggtgaagatctaagacatttaatagtatcgagaagtacacaggcaccactaataatcagacctgattctggaaaccctcttgacactgtgttaaaggttttggagattttaggtaagaagtttcctgttactgagaactcaaagggttacaagttgctgccaccttatcttagagttattcaaggggatggagtagatattaataccttacaagagattgtagaaggcatgaaacaaaaaatgtggagtattgaaaatattgccttcggttctggtggaggtttgctacagaagttgacaagagatctcttgaattgttccttcaagtgtagctatgttgtaactaatggccttgggattaacgtcttcaaggacccagttgctgatcccaacaaaaggtccaaaaagggccgattatctttacataggacgccagcagggaattttgttacactggaggaaggaaaaggagaccttgaggaatatggtcaggatcttctccatactgtcttcaagaatggcaaggtgacaaaaagctattcatttgatgaaataagaaaaaatgcacagctgaatattgaactggaagcagcacatcattag
Sequence Length
1476
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,521 Da
NCBI Official Full Name
Homo sapiens nicotinamide phosphoribosyltransferase, mRNA
NCBI Official Synonym Full Names
nicotinamide phosphoribosyltransferase
NCBI Official Symbol
NAMPT
NCBI Official Synonym Symbols
VF; PBEF; PBEF1; VISFATIN; 1110035O14Rik
NCBI Protein Information
nicotinamide phosphoribosyltransferase
UniProt Protein Name
Nicotinamide phosphoribosyltransferase
UniProt Gene Name
NAMPT
UniProt Synonym Gene Names
PBEF; PBEF1; NAmPRTase; Nampt; Pre-B cell-enhancing factor
UniProt Entry Name
NAMPT_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The NAMPT nampt (Catalog #AAA116379) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcctg cggcagaagc cgagttcaac atcctcctgg ccaccgactc ctacaaggtt actcactata aacaatatcc acccaacaca agcaaagttt attcctactt tgaatgccgt gaaaagaaga cagaaaactc caaattaagg aaggtgaaat atgaggaaac agtattttat gggttgcagt acattcttaa taagtactta aaaggtaaag tagtaaccaa agagaaaatc caggaagcca aagatgtcta caaagaacat ttccaagatg atgtctttaa tgaaaaggga tggaactaca ttcttgagaa gtatgatggg catcttccaa tagaaataaa agctgttcct gagggctttg tcattcccag aggaaatgtt ctcttcacgg tggaaaacac agatccagag tgttactggc ttacaaattg gattgagact attcttgttc agtcctggta tccaatcaca gtggccacaa attctagaga gcagaagaaa atattggcca aatatttgtt agaaacttct ggtaacttag atggtctgga atacaagtta catgattttg gctacagagg agtctcttcc caagagactg ctggcatagg agcatctgct cacttggtta acttcaaagg aacagataca gtagcaggac ttgctctaat taaaaaatat tatggaacga aagatcctgt tccaggctat tctgttccag cagcagaaca cagtaccata acagcttggg ggaaagacca tgaaaaagat gcttttgaac atattgtaac acagttttca tcagtgcctg tatctgtggt cagcgatagc tatgacattt ataatgcgtg tgagaaaata tggggtgaag atctaagaca tttaatagta tcgagaagta cacaggcacc actaataatc agacctgatt ctggaaaccc tcttgacact gtgttaaagg ttttggagat tttaggtaag aagtttcctg ttactgagaa ctcaaagggt tacaagttgc tgccacctta tcttagagtt attcaagggg atggagtaga tattaatacc ttacaagaga ttgtagaagg catgaaacaa aaaatgtgga gtattgaaaa tattgccttc ggttctggtg gaggtttgct acagaagttg acaagagatc tcttgaattg ttccttcaag tgtagctatg ttgtaactaa tggccttggg attaacgtct tcaaggaccc agttgctgat cccaacaaaa ggtccaaaaa gggccgatta tctttacata ggacgccagc agggaatttt gttacactgg aggaaggaaa aggagacctt gaggaatatg gtcaggatct tctccatact gtcttcaaga atggcaaggt gacaaaaagc tattcatttg atgaaataag aaaaaatgca cagctgaata ttgaactgga agcagcacat cattag. It is sometimes possible for the material contained within the vial of "NAMPT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.