NUP62 cdna clone
NUP62 cDNA Clone
Gene Names
NUP62; p62; IBSN; SNDI
Synonyms
NUP62; N/A; NUP62 cDNA Clone; NUP62 cdna clone
Sequence
atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcctgttctcacttgccacccagactccggccacacagacgacaggcttcacttttggaacagcgactcttgcttcggggggaactggattttctttggggatcggtgcttcaaagctcaacttgagcaacacagctgccaccccagccatggcaaaccccagcggctttgggctgggcagcagcaacctcactaatgccatatcgagcaccgtcacctccagccagggcacagcacccaccggctttgtgtttggcccctccaccacctctgtggctccagctaccacatctggaggcttctcattcactggtggaagcacggcccaaccctccggtttcaacattggctcagcagggaattcagcccagcccacggcacctgccacgttgcccttcactccggccacgccagcagccaccacagcaggtgccacacagccagctgctcccacacccacagccaccatcaccagcactgggcccagcctctttgcgtcaatagcaactgctccaacctcatctgccaccactggactctccctctgtacccctgtgaccacagcgggcgcccccactgctgggacacagggcttcagcttaaaggcacctggagcagcttccggcacctccacaacaacatccaccgctgccaccgccaccgccaccaccaccagcagcagcagcaccaccggctttgccttgaatttaaaaccactggcgccagccgggatccccagcaatacagcagctgccgtgaccgctccacctggccctggcgcagctgcaggggcggctgccagctccgccatgacctacgcgcagctggagagcctgatcaacaaatggagcctggagctagaggaccaggagcggcacttcctccagcaggccacccaggtcaacgcctgggaccgcacgctgatcgagaatggagaaaagatcaccagcctgcaccgcgaggtggagaaggtgaagctggaccagaagaggctggaccaggagctcgacttcatcctgtcccagcagaaggagctggaagacctgctgagcccactggaggagttggtcaaggagcagagcgggaccatctacctgcagcacgcggatgaggagcgtgagaaaacctacaagctggctgagaacatcgacgcacagctcaagcgcatggcccaggatctcaaggacatcatcgagcacctgaacacgtccggggcccccgccgacaccagtgacccactgcagcagatctgcaagatcctcaatgcgcacatggactcactgcagtggatcgaccagaactcggccctgctgcagaggaaggtggaggaggtgaccaaggtgtgcgagggccggcgcaaggagcaggagcgcagcttccggatcacctttgactga
Sequence Length
1569
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,255 Da
NCBI Official Full Name
Homo sapiens nucleoporin 62kDa, mRNA
NCBI Official Synonym Full Names
nucleoporin 62kDa
NCBI Official Symbol
NUP62
NCBI Official Synonym Symbols
p62; IBSN; SNDI
NCBI Protein Information
nuclear pore glycoprotein p62; nucleoporin Nup62; 62 kDa nucleoporin
UniProt Protein Name
Nuclear pore glycoprotein p62
UniProt Gene Name
NUP62
UniProt Entry Name
NUP62_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The NUP62 nup62 (Catalog #AAA116423) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgggt ttaattttgg aggcactggg gcccctacag gcgggttcac gtttggcact gcaaagacgg caacaaccac acctgctaca gggttttctt tctccacctc tggcactgga gggtttaatt ttggggctcc cttccaacca gccacaagta ccccttccac cggcctgttc tcacttgcca cccagactcc ggccacacag acgacaggct tcacttttgg aacagcgact cttgcttcgg ggggaactgg attttctttg gggatcggtg cttcaaagct caacttgagc aacacagctg ccaccccagc catggcaaac cccagcggct ttgggctggg cagcagcaac ctcactaatg ccatatcgag caccgtcacc tccagccagg gcacagcacc caccggcttt gtgtttggcc cctccaccac ctctgtggct ccagctacca catctggagg cttctcattc actggtggaa gcacggccca accctccggt ttcaacattg gctcagcagg gaattcagcc cagcccacgg cacctgccac gttgcccttc actccggcca cgccagcagc caccacagca ggtgccacac agccagctgc tcccacaccc acagccacca tcaccagcac tgggcccagc ctctttgcgt caatagcaac tgctccaacc tcatctgcca ccactggact ctccctctgt acccctgtga ccacagcggg cgcccccact gctgggacac agggcttcag cttaaaggca cctggagcag cttccggcac ctccacaaca acatccaccg ctgccaccgc caccgccacc accaccagca gcagcagcac caccggcttt gccttgaatt taaaaccact ggcgccagcc gggatcccca gcaatacagc agctgccgtg accgctccac ctggccctgg cgcagctgca ggggcggctg ccagctccgc catgacctac gcgcagctgg agagcctgat caacaaatgg agcctggagc tagaggacca ggagcggcac ttcctccagc aggccaccca ggtcaacgcc tgggaccgca cgctgatcga gaatggagaa aagatcacca gcctgcaccg cgaggtggag aaggtgaagc tggaccagaa gaggctggac caggagctcg acttcatcct gtcccagcag aaggagctgg aagacctgct gagcccactg gaggagttgg tcaaggagca gagcgggacc atctacctgc agcacgcgga tgaggagcgt gagaaaacct acaagctggc tgagaacatc gacgcacagc tcaagcgcat ggcccaggat ctcaaggaca tcatcgagca cctgaacacg tccggggccc ccgccgacac cagtgaccca ctgcagcaga tctgcaagat cctcaatgcg cacatggact cactgcagtg gatcgaccag aactcggccc tgctgcagag gaaggtggag gaggtgacca aggtgtgcga gggccggcgc aaggagcagg agcgcagctt ccggatcacc tttgactga. It is sometimes possible for the material contained within the vial of "NUP62, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.