Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

P2RY11 cdna clone

P2RY11 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
P2RY11; P2Y11
Synonyms
P2RY11; N/A; P2RY11 cDNA Clone; P2RY11 cdna clone
Ordering
Sequence
atggcagccaacgtctcgggtgccaagtcctgccctgccaacttcttggcagctgccgacgacaaactcagtgggttccagggggacttcctgtggcccatactggtggttgagttcctggtggccgtggccagcaatggcctggccctgtaccgcttcagcatccggaagcagcgcccatggcaccccgccgtggtcttctctgtccagctggcagtcagcgacctgctctgcgctctgacgctgcccccgctggccgcctacctctatccccccaagcactggcgctatggggaggccgcgtgccgcctggagcgcttcctcttcacctgcaacctgctgggcagcgtcatcttcatcacctgcatcagcctcaaccgctacctgggcatcgtgcaccccttcttcgcccgaagccacctgcgacccaagcacgcctgggccgtgagcgctgccggctgggtcctggccgccctgctggccatgcccacactcagcttctcccacctgaagaggccgcagcagggggcgggcaactgcagcgtggccaggcccgaggcctgcatcaagtgtctggggacagcagaccacgggctggcggcctacagagcgtatagcctggtgctggcggggttgggctgcggcctgccgctgctgctcacgctggcagcctacggcgccctcgggcgggccgtgctacgcagcccaggcatgactgtggccgagaagctgcgtgtggcagcgttggtggccagtggtgtggccctctacgccagctcctatgtgccctaccacatcatgcgggtgctcaacgtggatgctcggcggcgctggagcacccgctgcccgagctttgcagacatagcccaggccacagcagccctggagctggggccctacgtgggctaccaggtgatgcggggcctcatgcccctggccttctgtgtccaccctctactctacatggccgcagtgcccagcctgggctgctgctgccgacactgccccggctacagggacagctggaacccagaggacgccaagagcactggccaagccctgcccctcaatgccacagccgcccctaaaccgtcagagccccagtcccgtgagctgagccaatga
Sequence Length
1125
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,345 Da
NCBI Official Full Name
Homo sapiens purinergic receptor P2Y, G-protein coupled, 11, mRNA
NCBI Official Synonym Full Names
purinergic receptor P2Y11
NCBI Official Symbol
P2RY11
NCBI Official Synonym Symbols
P2Y11
NCBI Protein Information
P2Y purinoceptor 11
UniProt Protein Name
P2Y purinoceptor 11
UniProt Gene Name
P2RY11
UniProt Synonym Gene Names
P2Y11
UniProt Entry Name
P2Y11_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The P2RY11 p2ry11 (Catalog #AAA116328) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcca acgtctcggg tgccaagtcc tgccctgcca acttcttggc agctgccgac gacaaactca gtgggttcca gggggacttc ctgtggccca tactggtggt tgagttcctg gtggccgtgg ccagcaatgg cctggccctg taccgcttca gcatccggaa gcagcgccca tggcaccccg ccgtggtctt ctctgtccag ctggcagtca gcgacctgct ctgcgctctg acgctgcccc cgctggccgc ctacctctat ccccccaagc actggcgcta tggggaggcc gcgtgccgcc tggagcgctt cctcttcacc tgcaacctgc tgggcagcgt catcttcatc acctgcatca gcctcaaccg ctacctgggc atcgtgcacc ccttcttcgc ccgaagccac ctgcgaccca agcacgcctg ggccgtgagc gctgccggct gggtcctggc cgccctgctg gccatgccca cactcagctt ctcccacctg aagaggccgc agcagggggc gggcaactgc agcgtggcca ggcccgaggc ctgcatcaag tgtctgggga cagcagacca cgggctggcg gcctacagag cgtatagcct ggtgctggcg gggttgggct gcggcctgcc gctgctgctc acgctggcag cctacggcgc cctcgggcgg gccgtgctac gcagcccagg catgactgtg gccgagaagc tgcgtgtggc agcgttggtg gccagtggtg tggccctcta cgccagctcc tatgtgccct accacatcat gcgggtgctc aacgtggatg ctcggcggcg ctggagcacc cgctgcccga gctttgcaga catagcccag gccacagcag ccctggagct ggggccctac gtgggctacc aggtgatgcg gggcctcatg cccctggcct tctgtgtcca ccctctactc tacatggccg cagtgcccag cctgggctgc tgctgccgac actgccccgg ctacagggac agctggaacc cagaggacgc caagagcact ggccaagccc tgcccctcaa tgccacagcc gcccctaaac cgtcagagcc ccagtcccgt gagctgagcc aatga. It is sometimes possible for the material contained within the vial of "P2RY11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.