PARK7 cdna clone
PARK7 cDNA Clone
Gene Names
PARK7; DJ1; DJ-1; HEL-S-67p
Synonyms
PARK7; N/A; PARK7 cDNA Clone; PARK7 cdna clone
Sequence
atggcttccaaaagagctctggtcatcctggctaaaggagcagaggaaatggagacggtcatccctgtagatgtcatgaggcgagctgggattaaggtcaccgttgcaggcctggctggaaaagacccagtacagtgtagccgtgatgtggtcatttgtcctgatgccagccttgaagatgcaaaaaaagagggaccatatgatgtggtggttctaccaggaggtaatctgggtgcacagaatttatctgagtctgctgctgtgaaggagatactgaaggagcaggaaaaccggaagggcctgatagccgccatctgtgcaggtcctactgctctgttggctcatgaaataggttttggaagtaaagttacaacacaccctcttgctaaagacaaaatgatgaatggaggtcattacacctactctgagaatcgtgtggaaaaagacggcctgattcttacaagccgggggcctgggaccagcttcgagtttgcgcttgcaattgttgaagccctgaatggcaaggaggtggcggctcaagtgaaggctccacttgttcttaaagactag
Sequence Length
570
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,891 Da
NCBI Official Full Name
Homo sapiens Parkinson disease (autosomal recessive, early onset) 7, mRNA
NCBI Official Synonym Full Names
Parkinsonism associated deglycase
NCBI Official Symbol
PARK7
NCBI Official Synonym Symbols
DJ1; DJ-1; HEL-S-67p
NCBI Protein Information
protein deglycase DJ-1
UniProt Protein Name
Protein deglycase DJ-1
UniProt Gene Name
PARK7
UniProt Synonym Gene Names
DJ-1
UniProt Entry Name
PARK7_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The PARK7 park7 (Catalog #AAA116365) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcca aaagagctct ggtcatcctg gctaaaggag cagaggaaat ggagacggtc atccctgtag atgtcatgag gcgagctggg attaaggtca ccgttgcagg cctggctgga aaagacccag tacagtgtag ccgtgatgtg gtcatttgtc ctgatgccag ccttgaagat gcaaaaaaag agggaccata tgatgtggtg gttctaccag gaggtaatct gggtgcacag aatttatctg agtctgctgc tgtgaaggag atactgaagg agcaggaaaa ccggaagggc ctgatagccg ccatctgtgc aggtcctact gctctgttgg ctcatgaaat aggttttgga agtaaagtta caacacaccc tcttgctaaa gacaaaatga tgaatggagg tcattacacc tactctgaga atcgtgtgga aaaagacggc ctgattctta caagccgggg gcctgggacc agcttcgagt ttgcgcttgc aattgttgaa gccctgaatg gcaaggaggt ggcggctcaa gtgaaggctc cacttgttct taaagactag. It is sometimes possible for the material contained within the vial of "PARK7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.