SLC25A37 cdna clone
SLC25A37 cDNA Clone
Gene Names
SLC25A37; MSC; MFRN; MSCP; HT015; MFRN1; PRO1278; PRO1584; PRO2217
Synonyms
SLC25A37; N/A; SLC25A37 cDNA Clone; SLC25A37 cdna clone
Sequence
atggagctgcgcagcgggagcgtgggcagccaggcggtggcgcggaggatggatggggacagccgagatggcggcggcggcaaggacgccaccgggtcggaggactacgagaacctgccgactagcgcctccgtgtccacccacatgacagcaggagcgatggccgggatcctggagcactcggtcatgtacccggtggactcggtgaagacacgaatgcagagtttgagtccagatcccaaagcccagtacacaagtatctacggagccctcaagaaaatcatgcggaccgaaggcttctggaggcccttgcgaggcgtcaacgtcatgatcatgggtgcagggccagcccatgccatgtattttgcctgctatgaaaacatgaaaaggactttaaatgacgttttccaccaccaaggaaacagccacctagccaacgggatagctgggagtatggccaccctgctccacgatgcggtaatgaatccagcagaagtggtgaagcagcgcttgcagatgtacaactcgcagcaccggtcagcaatcagctgcatccggacggtgtggaggaccgaggggttgggggccttctaccggagctacaccacgcagctgaccatgaacatccccttccagtccatccacttcatcacctatgagttcctgcaggagcaggtcaacccccaccggacctacaacccgcagtcccacatcatctcaggcgggctggccggggccctcgccgcggccgccacgacccccctggacgtctgtaagacccttctgaacactcaggagaacgtggccctctcgctggccaacatcagcggccggctgtcgggtatggccaatgccttccggacggtgtaccagctcaacggcctggccggctacttcaaaggcatccaggcgcgtgtcatctaccagatgccctccaccgccatttcttggtctgtctatgagttcttcaagtactttctcaccaagcgccagctggaaaatcgagctccatactaa
Sequence Length
1017
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,125 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25, member 37, mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 37
NCBI Official Symbol
SLC25A37
NCBI Official Synonym Symbols
MSC; MFRN; MSCP; HT015; MFRN1; PRO1278; PRO1584; PRO2217
NCBI Protein Information
mitoferrin-1
UniProt Protein Name
Mitoferrin-1
UniProt Gene Name
SLC25A37
UniProt Synonym Gene Names
MFRN; MSCP
UniProt Entry Name
MFRN1_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The SLC25A37 slc25a37 (Catalog #AAA116245) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctgc gcagcgggag cgtgggcagc caggcggtgg cgcggaggat ggatggggac agccgagatg gcggcggcgg caaggacgcc accgggtcgg aggactacga gaacctgccg actagcgcct ccgtgtccac ccacatgaca gcaggagcga tggccgggat cctggagcac tcggtcatgt acccggtgga ctcggtgaag acacgaatgc agagtttgag tccagatccc aaagcccagt acacaagtat ctacggagcc ctcaagaaaa tcatgcggac cgaaggcttc tggaggccct tgcgaggcgt caacgtcatg atcatgggtg cagggccagc ccatgccatg tattttgcct gctatgaaaa catgaaaagg actttaaatg acgttttcca ccaccaagga aacagccacc tagccaacgg gatagctggg agtatggcca ccctgctcca cgatgcggta atgaatccag cagaagtggt gaagcagcgc ttgcagatgt acaactcgca gcaccggtca gcaatcagct gcatccggac ggtgtggagg accgaggggt tgggggcctt ctaccggagc tacaccacgc agctgaccat gaacatcccc ttccagtcca tccacttcat cacctatgag ttcctgcagg agcaggtcaa cccccaccgg acctacaacc cgcagtccca catcatctca ggcgggctgg ccggggccct cgccgcggcc gccacgaccc ccctggacgt ctgtaagacc cttctgaaca ctcaggagaa cgtggccctc tcgctggcca acatcagcgg ccggctgtcg ggtatggcca atgccttccg gacggtgtac cagctcaacg gcctggccgg ctacttcaaa ggcatccagg cgcgtgtcat ctaccagatg ccctccaccg ccatttcttg gtctgtctat gagttcttca agtactttct caccaagcgc cagctggaaa atcgagctcc atactaa. It is sometimes possible for the material contained within the vial of "SLC25A37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.