Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

SPAM1 cdna clone

SPAM1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
SPAM1; HYA1; PH20; HYAL1; HYAL3; HYAL5; PH-20; SPAG15; HEL-S-96n
Synonyms
SPAM1; N/A; SPAM1 cDNA Clone; SPAM1 cdna clone
Ordering
Sequence
atgggagtgctaaaattcaagcacatctttttcagaagctttgttaaatcaagtggagtatcccagatagttttcaccttccttctgattccatgttgcttgactctgaatttcagagcacctcctgttattccaaatgtgcctttcctctgggcctggaatgccccaagtgaattttgtcttggaaaatttgatgagccactagatatgagcctcttctctttcataggaagcccccgaataaacgccaccgggcaaggtgttacaatattttatgttgatagacttggctactatccttacatagattcaatcacaggagtaactgtgaatggaggaatcccccagaagatttccttacaagaccatctggacaaagctaagaaagacattacattttatatgccagtagacaatttgggaatggctgttattgactgggaagaatggagacccacttgggcaagaaactggaaacctaaagatgtttacaagaataggtctattgaattggttcagcaacaaaatgtacaacttagtctcacagaggccactgagaaagcaaaacaagaatttgaaaaagcagggaaggatttcctggtagagactataaaattgggaaaattacttcggccaaatcacttgtggggttattatctttttccggattgttacaaccatcactataagaaacccggttacaatggaagttgcttcaatgtagaaataaaaagaaatgatgatctcagctggttgtggaatgaaagcactgctctttacccatccatttatttgaacactcagcagtctcctgtagctgctacactctatgtgcgcaatcgagttcgggaagccatcagagtttccaaaatacctgatgcaaaaagtccacttccggtttttgcatatacccgcatagtttttactgatcaagttttgaaattcctttctcaagatgaacttgtgtatacatttggcgaaactgttgctctgggtgcttctggaattgtaatatggggaaccctcagtataatgcgaagtatgaaatcttgcttgctcctagacaattacatggagactatactgaatccttacataatcaacgtcacactagcagccaaaatgtgtagccaagtgctttgccaggagcaaggagtgtgtataaggaaaaactggaattcaagtgactatcttcacctcaacccagataattttgctattcaacttgagaaaggtggaaagttcacagtacgtggaaaaccgacacttgaagacctggagcaattttctgaaaaattttattgcagctgttatagcaccttgagttgtaaggagaaagctgatgtaaaagacactgatgctgttgatgtgtgtattgctgatggtgtctgtatagatgcttttctaaaacctcccatggagacagaagaacctcaaattttctacaatgcttcaccctccacactatctgccacaatgttcatttggaggctggaagtctgggatcaaggtattagcagaattggtttcttctga
Sequence Length
1536
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,395 Da
NCBI Official Full Name
Homo sapiens sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding), mRNA
NCBI Official Synonym Full Names
sperm adhesion molecule 1
NCBI Official Symbol
SPAM1
NCBI Official Synonym Symbols
HYA1; PH20; HYAL1; HYAL3; HYAL5; PH-20; SPAG15; HEL-S-96n
NCBI Protein Information
hyaluronidase PH-20
UniProt Protein Name
Hyaluronidase PH-20
UniProt Gene Name
SPAM1
UniProt Synonym Gene Names
HYAL3; PH20; Hyal-PH20
UniProt Entry Name
HYALP_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The SPAM1 spam1 (Catalog #AAA116407) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagtgc taaaattcaa gcacatcttt ttcagaagct ttgttaaatc aagtggagta tcccagatag ttttcacctt ccttctgatt ccatgttgct tgactctgaa tttcagagca cctcctgtta ttccaaatgt gcctttcctc tgggcctgga atgccccaag tgaattttgt cttggaaaat ttgatgagcc actagatatg agcctcttct ctttcatagg aagcccccga ataaacgcca ccgggcaagg tgttacaata ttttatgttg atagacttgg ctactatcct tacatagatt caatcacagg agtaactgtg aatggaggaa tcccccagaa gatttcctta caagaccatc tggacaaagc taagaaagac attacatttt atatgccagt agacaatttg ggaatggctg ttattgactg ggaagaatgg agacccactt gggcaagaaa ctggaaacct aaagatgttt acaagaatag gtctattgaa ttggttcagc aacaaaatgt acaacttagt ctcacagagg ccactgagaa agcaaaacaa gaatttgaaa aagcagggaa ggatttcctg gtagagacta taaaattggg aaaattactt cggccaaatc acttgtgggg ttattatctt tttccggatt gttacaacca tcactataag aaacccggtt acaatggaag ttgcttcaat gtagaaataa aaagaaatga tgatctcagc tggttgtgga atgaaagcac tgctctttac ccatccattt atttgaacac tcagcagtct cctgtagctg ctacactcta tgtgcgcaat cgagttcggg aagccatcag agtttccaaa atacctgatg caaaaagtcc acttccggtt tttgcatata cccgcatagt ttttactgat caagttttga aattcctttc tcaagatgaa cttgtgtata catttggcga aactgttgct ctgggtgctt ctggaattgt aatatgggga accctcagta taatgcgaag tatgaaatct tgcttgctcc tagacaatta catggagact atactgaatc cttacataat caacgtcaca ctagcagcca aaatgtgtag ccaagtgctt tgccaggagc aaggagtgtg tataaggaaa aactggaatt caagtgacta tcttcacctc aacccagata attttgctat tcaacttgag aaaggtggaa agttcacagt acgtggaaaa ccgacacttg aagacctgga gcaattttct gaaaaatttt attgcagctg ttatagcacc ttgagttgta aggagaaagc tgatgtaaaa gacactgatg ctgttgatgt gtgtattgct gatggtgtct gtatagatgc ttttctaaaa cctcccatgg agacagaaga acctcaaatt ttctacaatg cttcaccctc cacactatct gccacaatgt tcatttggag gctggaagtc tgggatcaag gtattagcag aattggtttc ttctga. It is sometimes possible for the material contained within the vial of "SPAM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.