Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

TDO2 cdna clone

TDO2 cDNA Clone

Gene Names
TDO2; TO; TDO; TPH2; TRPO
Synonyms
TDO2; N/A; TDO2 cDNA Clone; TDO2 cdna clone
Ordering
Sequence
atgagtgggtgcccatttttaggaaacaactttggatatacttttaaaaaactccccgtagaaggcagcgaagaagacaaatcacaaactggtgtgaatagagccagcaaaggaggtcttatctatgggaactacctgcatttggaaaaagttttgaatgcacaagaactgcaaagtgaaacaaaaggaaataaaatccatgatgaacatctttttatcataactcatcaagcttatgaactctggtttaagcaaatcctctgggagttggattctgttcgagagatctttcagaatggccatgtcagagatgaaaggaacatgcttaaggttgtttctcggatgcaccgagtgtcagtgatcctgaaactgctggtgcagcagttttccattctggagacgatgacagccttggacttcaatgacttcagagagtacttatctccagcatcaggcttccagagtttgcaattccgactattagaaaacaagataggtgttcttcagaacatgagagtcccttataacagaagacattatcgtgataacttcaaaggagaagaaaatgaactgctacttaaatctgagcaggaaaagacacttctggaattagtggaggcatggctggaaagaactccaggtttagagccacatggatttaacttctggggaaagcttgaaaaaaatatcaccagaggcctggaagaggaattcataaggattcaggctaaagaagagtctgaagaaaaagaggaacaggtggctgaatttcagaagcaaaaagaggtgctactgtccttatttgatgagaaacgtcatgaacatctccttagtaaaggtgaaagacggctgtcatacagagcacttcagggagcattgatgatatatttttacagggaagagcctaggttccaggtgccttttcagttgctgacttctcttatggacatagattcactgatgaccaaatggagatataaccatgtgtgcatggtgcacagaatgctgggcagcaaagctggcaccggtggttcctcaggctatcactacctgcgatcaactgtgagtgataggtacaaggtatttgtagatttatttaatctttcaacatacctgattccccgacactggataccgaagatgaacccaaccattcacaaatttctatatacagcagaatactgtgatagctcctacttcagcagtgatgaatcagattaa
Sequence Length
1221
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,872 Da
NCBI Official Full Name
Homo sapiens tryptophan 2,3-dioxygenase, mRNA
NCBI Official Synonym Full Names
tryptophan 2,3-dioxygenase
NCBI Official Symbol
TDO2
NCBI Official Synonym Symbols
TO; TDO; TPH2; TRPO
NCBI Protein Information
tryptophan 2,3-dioxygenase
UniProt Protein Name
Tryptophan 2,3-dioxygenase
UniProt Gene Name
TDO2
UniProt Synonym Gene Names
TDO; TO; TRPO
UniProt Entry Name
T23O_HUMAN

Similar Products

Product Notes

The TDO2 tdo2 (Catalog #AAA116289) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgggt gcccattttt aggaaacaac tttggatata cttttaaaaa actccccgta gaaggcagcg aagaagacaa atcacaaact ggtgtgaata gagccagcaa aggaggtctt atctatggga actacctgca tttggaaaaa gttttgaatg cacaagaact gcaaagtgaa acaaaaggaa ataaaatcca tgatgaacat ctttttatca taactcatca agcttatgaa ctctggttta agcaaatcct ctgggagttg gattctgttc gagagatctt tcagaatggc catgtcagag atgaaaggaa catgcttaag gttgtttctc ggatgcaccg agtgtcagtg atcctgaaac tgctggtgca gcagttttcc attctggaga cgatgacagc cttggacttc aatgacttca gagagtactt atctccagca tcaggcttcc agagtttgca attccgacta ttagaaaaca agataggtgt tcttcagaac atgagagtcc cttataacag aagacattat cgtgataact tcaaaggaga agaaaatgaa ctgctactta aatctgagca ggaaaagaca cttctggaat tagtggaggc atggctggaa agaactccag gtttagagcc acatggattt aacttctggg gaaagcttga aaaaaatatc accagaggcc tggaagagga attcataagg attcaggcta aagaagagtc tgaagaaaaa gaggaacagg tggctgaatt tcagaagcaa aaagaggtgc tactgtcctt atttgatgag aaacgtcatg aacatctcct tagtaaaggt gaaagacggc tgtcatacag agcacttcag ggagcattga tgatatattt ttacagggaa gagcctaggt tccaggtgcc ttttcagttg ctgacttctc ttatggacat agattcactg atgaccaaat ggagatataa ccatgtgtgc atggtgcaca gaatgctggg cagcaaagct ggcaccggtg gttcctcagg ctatcactac ctgcgatcaa ctgtgagtga taggtacaag gtatttgtag atttatttaa tctttcaaca tacctgattc cccgacactg gataccgaag atgaacccaa ccattcacaa atttctatat acagcagaat actgtgatag ctcctacttc agcagtgatg aatcagatta a. It is sometimes possible for the material contained within the vial of "TDO2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.