TNFRSF14 cdna clone
TNFRSF14 cDNA Clone
Gene Names
TNFRSF14; TR2; ATAR; HVEA; HVEM; CD270; LIGHTR
Synonyms
TNFRSF14; N/A; TNFRSF14 cDNA Clone; TNFRSF14 cdna clone
Sequence
atggagcctcctggagactgggggcctcctccctggagatccacccccagaaccgacgtcttgaggctggtgctgtatctcaccttcctgggagccccctgctacgccccagctctgccgtcctgcaaggaggacgagtacccagtgggctccgagtgctgccccaagtgcagtccaggttatcgtgtgaaggaggcctgcggggagctgacgggcacagtgtgtgaaccctgccctccaggcacctacattgcccacctcaatggcctaagcaagtgtctgcagtgccaaatgtgtgacccagccatgggcctgcgcgcgagccggaactgctccaggacagagaacgccgtgtgtggctgcagcccaggccacttctgcatcgtccaggacggggaccactgcgccgcgtgccgcgcttacgccacctccagcccgggccagagggtgcagaagggaggcaccgagagtcaggacaccctgtgtcagaactgccccccggggaccttctctcccaatgggaccctggaggaatgtcagcaccagaccaagtgcagctggctggtgacgaaggccggagctgggaccagcagctcccactgggtatggtggtttctctcagggagcctcgtcatcgtcattgtttgctccacagttggcctaatcatatgtgtgaaaagaagaaagccaaggggtgatgtagtcaaggtgatcgtctccgtccagcggaaaagacaggaggcagaaggtgaggccacagtcattgaggccctgcaggcccctccggacgtcaccacggtggccgtggaggagacaataccctcattcacggggaggagcccaaaccactga
Sequence Length
852
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
Related Product Information for TNFRSF14 cdna clone
Homo sapiens tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator), mRNA (cDNA clone MGC:3753 IMAGE:3614650), complete cds.
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,392 Da
NCBI Official Full Name
Homo sapiens tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator), mRNA
NCBI Official Synonym Full Names
tumor necrosis factor receptor superfamily, member 14
NCBI Official Symbol
TNFRSF14
NCBI Official Synonym Symbols
TR2; ATAR; HVEA; HVEM; CD270; LIGHTR
NCBI Protein Information
tumor necrosis factor receptor superfamily member 14; CD40-like protein; herpesvirus entry mediator A; herpes virus entry mediator A; tumor necrosis factor receptor-like 2; tumor necrosis factor receptor-like gene2; tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
UniProt Protein Name
Tumor necrosis factor receptor superfamily member 14
UniProt Gene Name
TNFRSF14
UniProt Synonym Gene Names
HVEA; HVEM; Herpesvirus entry mediator A; HveA; TR2
UniProt Entry Name
TNR14_HUMAN
Similar Products
Product Notes
The TNFRSF14 tnfrsf14 (Catalog #AAA116241) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcctc ctggagactg ggggcctcct ccctggagat ccacccccag aaccgacgtc ttgaggctgg tgctgtatct caccttcctg ggagccccct gctacgcccc agctctgccg tcctgcaagg aggacgagta cccagtgggc tccgagtgct gccccaagtg cagtccaggt tatcgtgtga aggaggcctg cggggagctg acgggcacag tgtgtgaacc ctgccctcca ggcacctaca ttgcccacct caatggccta agcaagtgtc tgcagtgcca aatgtgtgac ccagccatgg gcctgcgcgc gagccggaac tgctccagga cagagaacgc cgtgtgtggc tgcagcccag gccacttctg catcgtccag gacggggacc actgcgccgc gtgccgcgct tacgccacct ccagcccggg ccagagggtg cagaagggag gcaccgagag tcaggacacc ctgtgtcaga actgcccccc ggggaccttc tctcccaatg ggaccctgga ggaatgtcag caccagacca agtgcagctg gctggtgacg aaggccggag ctgggaccag cagctcccac tgggtatggt ggtttctctc agggagcctc gtcatcgtca ttgtttgctc cacagttggc ctaatcatat gtgtgaaaag aagaaagcca aggggtgatg tagtcaaggt gatcgtctcc gtccagcgga aaagacagga ggcagaaggt gaggccacag tcattgaggc cctgcaggcc cctccggacg tcaccacggt ggccgtggag gagacaatac cctcattcac ggggaggagc ccaaaccact ga. It is sometimes possible for the material contained within the vial of "TNFRSF14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.