TXNRD1 cdna clone
TXNRD1 cDNA Clone
Gene Names
TXNRD1; TR; TR1; TXNR; TRXR1; GRIM-12
Synonyms
TXNRD1; N/A; TXNRD1 cDNA Clone; TXNRD1 cdna clone
Sequence
atgaacggccctgaagatcttcccaagtcctatgactatgaccttatcatcattggaggtggctcaggaggtctggcagctgctaaggaggcagcccaatatggcaagaaggtgatggtcctggactttgtcactcccacccctcttggaactagatggggtcttggaggaacatgtgtgaatgtgggttgcatacctaaaaaactgatgcatcaagcagctttgttaggacaagccctgcaagactctcgaaattatggatggaaagtcgaggagacagttaagcatgattgggacagaatgatagaagctgtacagaatcacattggctctttgaattggggctaccgagtagctctgcgggagaaaaaagtcgtctatgagaatgcttatgggcaatttattggtcctcacaggattaaggcaacaaataataaaggcaaagaaaaaatttattcagcagagagatttctcattgccactggtgaaagaccacgttacttgggcatccctggtgacaaagaatactgcatcagcagtgatgatcttttctccttgccttactgcccgggtaagaccctggttgttggagcatcctatgtcgctttggagtgcgctggatttcttgctggtattggtttagacgtcactgttatggttaggtccattcttcttagaggatttgaccaggacatggccaacaaaattggtgaacacatggaagaacatggcatcaagtttataagacagttcgtaccaattaaagttgaacaaattgaagcagggacaccaggccgactcagagtagtagctcagtccaccaatagtgaggaaatcattgaaggagaatataatacggtgatgctggcaataggaagagatgcttgcacaagaaaaattggcttagaaaccgtaggggtgaagataaatgaaaagactggaaaaatacctgtcacagatgaagaacagaccaatgtgccttacatctatgccattggcgatatattggaggataaggtggagctcaccccagttgcaatccaggcaggaagattgctggctcagaggctctatgcaggttccactgtcaagtgtgactatgaaaatgttccaaccactgtatttactcctttggaatatggtgcttgtggcctttctgaggagaaagctgtggagaagtttggggaagaaaatattgaggtttaccatagttacttttggccattggaatggacgattccgtcaagagataacaacaaatgttatgcaaaaataatctgtaatactaaagacaatgaacgtgttgtgggctttcacgtactgggtccaaatgctggagaagttacacaaggctttgcagctgcgctcaaatgtggactgaccaaaaagcagctggacagcacaattggaatccaccctgtctgtgcagaggtattcacaacattgtctgtgaccaagcgctctggggcaagcatcctccaggctggctgctgaggttaa
Sequence Length
1500
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,873 Da
NCBI Official Full Name
Homo sapiens thioredoxin reductase 1, mRNA
NCBI Official Synonym Full Names
thioredoxin reductase 1
NCBI Official Symbol
TXNRD1
NCBI Official Synonym Symbols
TR; TR1; TXNR; TRXR1; GRIM-12
NCBI Protein Information
thioredoxin reductase 1, cytoplasmic
UniProt Protein Name
Thioredoxin reductase 1, cytoplasmic
UniProt Gene Name
TXNRD1
UniProt Synonym Gene Names
GRIM12; KDRF; TR; GRIM-12; Gene associated with retinoic and IFN-induced mortality 12 protein
UniProt Entry Name
TRXR1_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The TXNRD1 txnrd1 (Catalog #AAA116298) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacggcc ctgaagatct tcccaagtcc tatgactatg accttatcat cattggaggt ggctcaggag gtctggcagc tgctaaggag gcagcccaat atggcaagaa ggtgatggtc ctggactttg tcactcccac ccctcttgga actagatggg gtcttggagg aacatgtgtg aatgtgggtt gcatacctaa aaaactgatg catcaagcag ctttgttagg acaagccctg caagactctc gaaattatgg atggaaagtc gaggagacag ttaagcatga ttgggacaga atgatagaag ctgtacagaa tcacattggc tctttgaatt ggggctaccg agtagctctg cgggagaaaa aagtcgtcta tgagaatgct tatgggcaat ttattggtcc tcacaggatt aaggcaacaa ataataaagg caaagaaaaa atttattcag cagagagatt tctcattgcc actggtgaaa gaccacgtta cttgggcatc cctggtgaca aagaatactg catcagcagt gatgatcttt tctccttgcc ttactgcccg ggtaagaccc tggttgttgg agcatcctat gtcgctttgg agtgcgctgg atttcttgct ggtattggtt tagacgtcac tgttatggtt aggtccattc ttcttagagg atttgaccag gacatggcca acaaaattgg tgaacacatg gaagaacatg gcatcaagtt tataagacag ttcgtaccaa ttaaagttga acaaattgaa gcagggacac caggccgact cagagtagta gctcagtcca ccaatagtga ggaaatcatt gaaggagaat ataatacggt gatgctggca ataggaagag atgcttgcac aagaaaaatt ggcttagaaa ccgtaggggt gaagataaat gaaaagactg gaaaaatacc tgtcacagat gaagaacaga ccaatgtgcc ttacatctat gccattggcg atatattgga ggataaggtg gagctcaccc cagttgcaat ccaggcagga agattgctgg ctcagaggct ctatgcaggt tccactgtca agtgtgacta tgaaaatgtt ccaaccactg tatttactcc tttggaatat ggtgcttgtg gcctttctga ggagaaagct gtggagaagt ttggggaaga aaatattgag gtttaccata gttacttttg gccattggaa tggacgattc cgtcaagaga taacaacaaa tgttatgcaa aaataatctg taatactaaa gacaatgaac gtgttgtggg ctttcacgta ctgggtccaa atgctggaga agttacacaa ggctttgcag ctgcgctcaa atgtggactg accaaaaagc agctggacag cacaattgga atccaccctg tctgtgcaga ggtattcaca acattgtctg tgaccaagcg ctctggggca agcatcctcc aggctggctg ctgaggttaa. It is sometimes possible for the material contained within the vial of "TXNRD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.