Filters
▼Clonality
▼Type
▼Reactivity
▼Gene Name
▼Isotype
▼Host
▼Application
▼Clone
▼Recombinant Proteins
Recombinant proteins are purified laboratory reagents created through genetic engineering for advanced biomedical research, such as immunology, neuroscience, cancer research, and more.
At AAA Biotech, also known as AAA Bio or AAABio, we provide high-quality recombinant proteins. Our various protein products are carefully tested for consistent and reliable performance. With our proteins, we offer stringent quality control, lot-to-lot consistency, and precise specificity to help you achieve accurate results in your research.
Whether you're conducting research on cell expansion, polarization, differentiation, or cell processing, we can offer the exact recombinant proteins you need in order to support your work.
Viewing 6650-6700 of 10000 product results
Application Data
(Figure 3. Binding ability measured in a functional ELISA. Immobilized human ACE2(19-740) protein (Fc tag) can bind to SARS-CoV Spike Protein S1 (His tag).)
SARS-CoV Spike S1, Recombinant Protein (Cat# AAA73181)
SDS-PAGE
(Purity: The purity was determined to be >90% by densitometry.)
COVID 19 Nucleocapsid CTD Coronavirus, Recombinant Protein (Cat# AAA73317)
SDS-PAGE
(Purity: Sample Purity Data. For specific information on a given lot, see related technical data sheet.)
SDS-PAGE
(Purity: Sample purity data. for lot-specific data, please refer to the lot-specific datasheet.)
SDS-PAGE
(Purity: Sample Purity Data. For specific information on a given lot, see related technical data sheet.)
NNMT, Recombinant Protein (Cat# AAA73777)
SDS-PAGE
(Purity: Sample Purity Data. For specific information on a given lot, see related technical data sheet.)
FLT3-ITD-NPOS, Recombinant Protein (Cat# AAA73566)
SDS-PAGE
STC2 / Stanniocalcin 2, Recombinant Protein (Cat# AAA173525)
SDS-PAGE
(3ug by SDS-PAGE under reducing condition and visualized by coomassie blue stain)
RNASE2, Recombinant Protein (Cat# AAA48414)
SDS-PAGE
Phosphoserine phosphatase, Recombinant Protein (Cat# AAA48447)
SDS-PAGE
Interleukin-1, Recombinant Protein (Cat# AAA48460)
SDS-PAGE
(3ug by SDS-PAGE under reducing condition and visualized by coomassie blue stain.)
CD163, Recombinant Protein (Cat# AAA48971)
Application Data
(Recombinant SMARCA4 / BRG1 (1448-1569) HTRF activity assay. 3 uM H3K14ac peptide was incubated with different concentrations of SMARCA4 / BRG1 (1448-1569) protein in a 10 ul binding system containing 50 mM HEPES-NaOH pH 7.4, and 0.1% BSA for 1 hour, then 10 ul Anti-GST antibody and SA-XL665 mixture (each 1:100 dilution in Binding Buffer) was added to each reaction system and incubated for 30 min. All the operations and reactions were performed at room temperature. HTRF assay was used for detection.)
SMARCA4/BRG1, Recombinant Protein (Cat# AAA59711)
WB (Western Blot)
(Recombinant KAT7 protein activity assay 0.5 ug Histone H4 was incubated with 0 ug (-), 0.4 ug (+) KAT7 in 20 ul reaction system for 2 hours at room temperature. Half of each reaction was run on a 13% SDS-PAGE gel, and products were detected by Western blot. H4ac (pan-acetyl) antibody was used to recognize acetylated histone H4.)
KAT7, Recombinant Protein (Cat# AAA59716)
Application Data
(MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)
METTL3/METTL14, Recombinant Protein (Cat# AAA59755)
WB (Western Blot)
(Western Blot analysis for Recombinant Mono-nucleosomes H3K9ac (EPL) Unmodified nucleosomes (Lane 1) and Recombinant Mononucleosomes H3K9ac (EPL) (Lane 2) were detected with H3K9ac antibody and H4 antibody , respectively. H3 was detected as loading control. Only Recombinant Mononucleosomes H3K9ac (EPL) can be detected by anti-H3K9ac antibody.)
Mononucleosomes H3K9ac, Recombinant Protein (Cat# AAA60123)
Application Data
(HTRF assay for VRK1 activity STK S1 substrate was incubated with different concentrations of VRK1 protein in a reaction system for 1 hour. The detection reagents were added and incubated with the reactions for 1 hr. All the operations and reactions were performed at room temperature, and HTRF KinASE STK assay was used to detect the enzymatic activity.)
VRK1, Recombinant Protein (Cat# AAA60130)
WB (Western Blot)
(Western Blot analysis for Recombinant Mononucleosomes H3K27me3 (MLA) Recombinant Mononucleosomes H3K27me3 (MLA) (Lane 1) and unmodified nucleosomes (Lane 2) were detected with H3K27me3 antibody and H4 antibody , respectively. Only Recombinant Mononucleosomes H3K27me3 (MLA) can be detected by H3K27me3 antibody and H4 was detected as loading control.)
Mononucleosomes H3K27me3, Recombinant Protein (Cat# AAA60150)
Application Data
(HTRF assay for GSK3b activity 1 uM STK S3 substrate was incubated with different concentrations of GSK3b protein in a 10 ul reaction system containing 1×Enzymatic Buffer, 5 mM MgCl2, 1 mM DTT and 100 uM ATP for 1 hour. The detection reagents were added and incubated with the reactions for 1 hr. All the operations and reactions were performed at room temperature, and HTRF KinASE STK assay was used to detect the enzymatic activity.)
Application Data
(HTRF assay for YTHDF3 protein activity 3 uM biotinylated m6A ssDNA oligos (GTTGG/m6A/CTT) were incubated with different concentrations of YTHDF3 protein in a 10 ul system containing 50 mM HEPES-NaOH pH 7.4, 0.1% BSA for 1 hr, then 10 ul DYKDDDDK antibody and SA-XL665 mixture (each 1:100 dilution in reaction buffer) was added to each reaction system and incubated for 30 min. All the operations and reactions were performed at room temperature. HTRF assay was used for detection.)
Application Data
(SETD2 (1418-1714) activity assay. Recombinant SETD2 (1418-1714) activity measured using a chemiluminescent methyltransferase assay.)
Application Data
(HTRF Assay for Recombinant PRC2 EZH2(Y641F) complex activity. 1 ?M histone H3K27me2 (21-44aa.) peptide was incubated with different concentrations of Recombinant PRC2 EZH2 (Y641F) Complex in reaction buffer including 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, 1 mM TCEP and 50 ?M SAM for 3 hours at room temperature. Then 10 ?l anti-H3K27me3 antibody and SA-XL665 mixture (1:100 dilution in HTRF Detection Buffer) was added to each reaction system and incubated for 30 min at room temperature. HTRF assay was used for detection. Fluorenscence intensity at 620 nm and 665 nm were measured respectively. The final HTRF signal was obtained by formula: HTRF signal = F665/F620*10000.)
PRC2 EZH2, Recombinant Protein (Cat# AAA59653)
Application Data
(Recombinant DNMT3A protein activity assay Recombinant DNMT3A protein activity was measured using DNMT Activity / Inhibition Assay, for 1 hour at 37 degree C)
DNMT3A, Recombinant Protein (Cat# AAA59662)
SDS-PAGE
PGLS, Recombinant Protein (Cat# AAA48660)
SDS-PAGE
MAP1LC3B, Recombinant Protein (Cat# AAA48664)
SDS-PAGE
(3ug by SDS-PAGE under reducing condition and visualized by coomassie blue stain)
ARHGDIA, Recombinant Protein (Cat# AAA48671)
SDS-PAGE
eFIMC, Recombinant Protein (Cat# AAA48681)
SDS-PAGE
(3ug by SDS-PAGE under reducing condition and visualized by coomassie blue stain.)
PSMB5, Recombinant Protein (Cat# AAA48691)
SDS-PAGE
CD40, Recombinant Protein (Cat# AAA48856)
SDS-PAGE
NKIRAS2, Recombinant Protein (Cat# AAA48769)
SDS-PAGE
FAM84A, Recombinant Protein (Cat# AAA48797)
SDS-PAGE
(3ug by SDS-PAGE under reducing condition and visualized by coomassie blue stain)
OCT4, Recombinant Protein (Cat# AAA48802)
SDS-PAGE
(3ug by SDS-PAGE under reducing condition and visualized by coomassie blue stain)
GP9, Recombinant Protein (Cat# AAA48805)
SDS-PAGE
Vasostatin 2, Recombinant Protein (Cat# AAA48490)
SDS-PAGE
CXCL1/GRO alpha, Recombinant Protein (Cat# AAA48507)
SDS-PAGE
Lymphotactin/XCL1, Recombinant Protein (Cat# AAA48535)
SDS-PAGE
(3 ug by SDS-PAGE under reducing coditions and visualized by coomassie blue stain.)
RAC2, Recombinant Protein (Cat# AAA48552)
SDS-PAGE
IL12P40, Recombinant Protein (Cat# AAA48721)
SDS-PAGE
BTC, Recombinant Protein (Cat# AAA48743)
SDS-PAGE
KARS, Recombinant Protein (Cat# AAA48748)
Intercellular Adhesion Molecule-1 (ICAM-1), Recombinant Protein (Cat# AAA58745)
Paraoxonase 1 (PO-1), Recombinant Protein (Cat# AAA58756)
SDS-PAGE
(Figure 1. Human MICA Protein, His Tag on SDS-PAGE under reducing condition.)
MICA, Recombinant Protein (Cat# AAA47334)
SDS-PAGE
(Figure 1. Human GAST Protein, hFc Tag on SDS-PAGE under reducing condition.)
Gastrin, Recombinant Protein (Cat# AAA47383)
SDS-PAGE
(Figure 1. Human IL21 Protein, hFc Tag on SDS-PAGE under reducing condition.)
IL21, Recombinant Protein (Cat# AAA47393)
Cardiac Troponin T (TnT), Recombinant Protein (Cat# AAA47961)
Cytokeratin 8, Recombinant Protein (Cat# AAA75419)
PIGF1, Recombinant Protein (Cat# AAA75200)
SDS-PAGE
(Purity: Sample Purity Data. For specific information on a given lot, see related technical data sheet.)
SDS-PAGE
(Tau Proteins: Representation of seven Tau proteins, from top to bottom: Tau-441, Tau-410, Tau-412, Tau-381, Tau-383, Tau-352 and Tau-316 (Tau Protein Marker).)
Tau-381, Recombinant Protein (Cat# AAA73998)
SDS-PAGE
(Purity: Sample Purity Data. For specific information on a given lot, see related technical data sheet.)
TFG-MET, Recombinant Protein (Cat# AAA73722)
What Are Recombinant Proteins?
A recombinant protein is created by inserting the gene of interest into a host system like E. coli, mammalian cells, or insect cells. This protein expression method results in the large-scale production of protein in a controlled environment with highly precise structures and functionality. Proteins produced via the “Recombinant” methodology have proven themselves crucial in various biological research areas, including immunology, neuroscience, cancer research, drug delivery and development, and more.
Core Recombinant Protein Product Lines:
- Human: Produced from human genes (e.g., growth factors, cytokines).
- Animal: Derived from mouse, rat, or other animals (e.g., mouse antibodies, enzymes).
- Bacterial: Produced in bacteria like E. coli (e.g., enzymes, bacterial toxins).
- Yeast: Produced in yeast cells (e.g., surface proteins, metabolic enzymes).
- Insect:Expressed in insect cells (e.g., viral proteins, glycoproteins).
- Viral: Derived from viral genomes (e.g., spike proteins for vaccine development).
How Does It Work?
- Gene Identification and Cloning: Scientists first find the exact gene that codes for the protein they are interested in producing, and then create a copy of said gene.
- Recombinant DNA Creation: The copied gene is then inserted into a vector (a vehicle-like plasmid) that can be transported safely into your intended expression host cell/system.
- Host Cell Transformation: The vector (with the foreign gene inside) is shuttled into a host cell. This host can be a bacterium (like E. coli), yeast, insect cells, or mammalian cells, depending on the type of protein or protein characteristics needed.
- Protein Expression:The host cell “reads” the copied gene that was shuttled into it, and begins to produce the gene’s coded-for protein using its own cellular machinery. The host can continue to multiply, and with each new cell, more protein is produced.
- Protein Purification:After enough protein has been made, scientists collect the host cell and separate out the target protein. The protein is then carefully purified so it is free of contaminants, ideally active, and also safe for use.
The result is a purified recombinant protein — a lab-made protein that is biologically identical (in most respects) to the natural/native version.
We take this process a step further, offering recombinant proteins that are produced with precise control over sequence modifications, expression levels, and large-scale production. This ensures high-quality, consistent results that will be able to support your research needs and empower your scientific discoveries.
Some of the expression hosts/systems used in recombinant protein generation by AAA Biotech include:
- Escherichia coli (E. coli)
- Human (Homo sapiens)
- Chinese Hamster
- Yeast
- Insect cells (e.g., Baculovirus expression system)
Advantages Of Our Recombinant Proteins:
Recombinant Protein Offerings
| S.No | Protein Expression Systems | Quality and Bioactivity | Formats and Flexibility |
|---|---|---|---|
| 01. | E. coli, HEK293, CHO, yeast, and insect cells | Validated high bioactivity and binding activity | Ready-to-use formats (lyophilized or liquid formulations available) |
| 02. | 675+ recombinant protein products | High protein purity (≥95%) | Available in flexible pack sizes |
| 03. | Custom protein production (His-tag, GST, FLAG, and Fc fusion) | Lot-to-lot consistency through QC protocols | Wide range of targets (Cytokines, growth factors, enzymes, receptors, signaling proteins, etc.) |
Applications Of Our Recombinant Proteins
- Studying protein interactions (protein–protein or protein–DNA).
- Testing biological pathways with functional/activity assays.
- Creating standard curves in ELISA and other tests.
- Making antigens/immunogens for antibody production.
- Drug discovery and screening.
- Finding and confirming biomarkers.
- Researching cell signaling and immunity.
- Developing vaccines.
Read more about the applications of the recombinant proteins here!
Why Buy Recombinant Proteins from AAA Biotech?
1. High Purity & Verified Quality:
Most of our proteins are ≥ 95% pure. We also test the biological activity of our products where it's relevant (it will be indicated on the product page).
2. Multiple Expression Systems:
We offer proteins made in multiple host systems, and this enables researchers to pick the system that gives them the best folding, post-translational modifications, or functionality for their experiment requirements.
3. Custom & Flexible Options:
Need a special tag (His, GST, FLAG, Fc fusion)? Or a custom variant? We can provide it. Our proteins come in formats that are lab-friendly: lyophilized (dry) or “ready-to-use” liquid.
4. Rigorous Quality Control & Documentation:
Every batch is backed by strong QC. This means you can rely on product consistency — two different batches will perform similarly.
5. Wide Variety & Global Availability:
We carry a large and growing catalog of recombinant proteins to cover almost all needs in research (immunology, oncology, vaccine work, etc.)
6. Researcher-Focused Support:
Technical support, clear documentation, and user-friendly product pages help you select the right protein for your work. Plus, our user-friendly packaging and handling, and global shipping are all designed to reduce delays, damage, and hassles.
Order Recombinant Proteins Today!
We are committed to supporting the research community with recombinant proteins that display exceptional performance and reliability. Our proteins are produced using industry-standard methods and are validated to meet the needs of academic, pharmaceutical, and biotechnology laboratories.
We have a track record of delivering proteins that work — large numbers of researchers rely on them in many published studies. Browse our catalog to find the perfect protein for your research applications now!
FAQ
1. What is involved in the purification of recombinant proteins?
The purification process of these recombinant proteins is performed to isolate the specific protein produced by the host cell from unwanted substances. The process generally includes techniques such as “affinity chromatography” to separate the protein from other proteins and impurities. AAA Biotech generally offers proteins ≥ 95% pure, depending on the protein type.
2. What are some examples of popular AAA Biotech recombinant proteins?
Some examples of recombinant proteins include:
Retinoblastoma Protein (Cat # AAA10852) – reportedly used in vaccine research and antibody development. Hepatitis B Surface Antigen (HBsAg) (Cat# AAA13446) – reportedly used in diagnostic tests and vaccine development for Hepatitis B. High-Mobility Group Box 1 (HMGB1) (Cat# AAA10851) – reportedly used in inflammation and immune response research.
3. How are AAA Biotech recombinant proteins validated?
Each batch undergoes stringent quality control checks, including SDS-PAGE analysis, endotoxin testing (for select products), and activity assaying (for select products). Certificates of Analysis are provided with every product (only upon request for some products).
4. Are your proteins suitable for therapeutic development or only research?
AAA Biotech recombinant proteins are strictly for research-use only and are not intended for diagnostic or therapeutic purposes in humans or animals.
5. What types of expression systems do you use for recombinant protein production?
The production labs use a variety of expression platforms, including bacterial (E. coli), yeast, insect (baculovirus), and mammalian (HEK293, CHO) systems. The expression system used depends on the complexity and intended function/use of the protein.