Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

ACSL4 cdna clone

ACSL4 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
ACSL4; ACS4; FACL4; LACS4; MRX63; MRX68
Synonyms
ACSL4; N/A; ACSL4 cDNA Clone; ACSL4 cdna clone
Ordering
Sequence
atggcaaagagaataaaagctaagcccacttcagacaaacctggaagtccatatcgctctgtcacacacttcgactcactagctgtaatagacatccctggagcagatactctggataaattatttgaccatgctgtatccaagtttgggaagaaggacagccttgggaccagggaaatcctaagtgaagaaaatgaaatgcagccaaatggaaaagtttttaagaagttaattcttgggaattataaatggatgaactatcttgaagtgaatcgcagagtgaataactttggtagtggactcactgcactgggactaaaaccaaagaacaccattgccatcttctgtgagaccagggccgaatggatgattgcagcacagacctgctttaagtacaactttcctcttgtgactttatatgccacacttggcaaagaagcagtagttcatgggctaaatgaatctgaggcttcctatctgattaccagtgttgaacttctggaaagtaaacttaagactgcattgttagatatcagttgtgttaaacatatcatttatgtggacaataaggctatcaataaagcagagtaccctgaaggatttgagattcacagcatgcaatcagtagaagagttgggatctaacccagaaaacttgggcattcctccaagtagaccaacgccttcagacatggccattgttatgtatactagtggttctactggccgacctaagggagtgatgatgcatcatagcaatttgatagctggaatgacaggccagtgtgaaagaatacctggactgggaccgaaggacacatatattggctacttgcctttggctcatgtgctagaactgacagcagagatatcttgctttacctatggctgcaggattggatattcttctccgcttacactctctgaccagtccagcaaaattaaaaaaggaagcaaaggagactgtactgtactgaagcccacacttatggctgctgttccggaaatcatggatagaatttataagaatgttatgagcaaagtccaagagatgaattatattcagaaaactctgttcaagatagggtatgattacaaattggaacagatcaaaaagggatatgatgcacctctttgcaatctgttactgtttaaaaaggtcaaggccctgctgggagggaatgtccgcatgatgctgtctggaggggccccgctatctcctcagacacaccgattcatgaatgtctgcttctgctgcccaattggccagggttatggactgacagaatcatgtggtgctgggacagttactgaagtaactgactatactactggcagagttggagcacctcttatttgctgtgaaattaagctaaaagactggcaagaaggcggttatacaattaatgacaagccaaaccccagaggtgaaatcgtaattggtggacagaacatctccatgggatattttaaaaatgaagagaaaacagcagaagattattctgtggatgaaaatggacaaaggtggttttgcactggtgatattggagaattccatcccgatggatgtttacagattatagatcgtaagaaagatctagtgaagttacaagcaggagagtatgtatctcttgggaaagtggaagctgcactgaagaattgtccacttattgacaacatctgtgcttttgccaaaagtgatcagtcctatgtgatcagttttgtggttcctaaccagaaaaggttgacacttttggcacaacagaaaggggtagaaggaacttgggttgatatctgcaataatcctgctatggaagctgaaatactgaaagaaattcgagaagctgcaaatgccatgaaattggagcgatttgaaattccaatcaaggttcgattaagcccagagccatggacccctgaaactggtttggtaactgatgctttcaaactgaaaaggaaggagctgaggaaccattacctcaaagacattgaacgaatgtatgggggcaaataa
Sequence Length
2013
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,436 Da
NCBI Official Full Name
Homo sapiens acyl-CoA synthetase long-chain family member 4, mRNA
NCBI Official Synonym Full Names
acyl-CoA synthetase long-chain family member 4
NCBI Official Symbol
ACSL4
NCBI Official Synonym Symbols
ACS4; FACL4; LACS4; MRX63; MRX68
NCBI Protein Information
long-chain-fatty-acid--CoA ligase 4
UniProt Protein Name
Long-chain-fatty-acid--CoA ligase 4
UniProt Gene Name
ACSL4
UniProt Synonym Gene Names
ACS4; FACL4; LACS4; LACS 4
UniProt Entry Name
ACSL4_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The ACSL4 acsl4 (Catalog #AAA116311) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaaaga gaataaaagc taagcccact tcagacaaac ctggaagtcc atatcgctct gtcacacact tcgactcact agctgtaata gacatccctg gagcagatac tctggataaa ttatttgacc atgctgtatc caagtttggg aagaaggaca gccttgggac cagggaaatc ctaagtgaag aaaatgaaat gcagccaaat ggaaaagttt ttaagaagtt aattcttggg aattataaat ggatgaacta tcttgaagtg aatcgcagag tgaataactt tggtagtgga ctcactgcac tgggactaaa accaaagaac accattgcca tcttctgtga gaccagggcc gaatggatga ttgcagcaca gacctgcttt aagtacaact ttcctcttgt gactttatat gccacacttg gcaaagaagc agtagttcat gggctaaatg aatctgaggc ttcctatctg attaccagtg ttgaacttct ggaaagtaaa cttaagactg cattgttaga tatcagttgt gttaaacata tcatttatgt ggacaataag gctatcaata aagcagagta ccctgaagga tttgagattc acagcatgca atcagtagaa gagttgggat ctaacccaga aaacttgggc attcctccaa gtagaccaac gccttcagac atggccattg ttatgtatac tagtggttct actggccgac ctaagggagt gatgatgcat catagcaatt tgatagctgg aatgacaggc cagtgtgaaa gaatacctgg actgggaccg aaggacacat atattggcta cttgcctttg gctcatgtgc tagaactgac agcagagata tcttgcttta cctatggctg caggattgga tattcttctc cgcttacact ctctgaccag tccagcaaaa ttaaaaaagg aagcaaagga gactgtactg tactgaagcc cacacttatg gctgctgttc cggaaatcat ggatagaatt tataagaatg ttatgagcaa agtccaagag atgaattata ttcagaaaac tctgttcaag atagggtatg attacaaatt ggaacagatc aaaaagggat atgatgcacc tctttgcaat ctgttactgt ttaaaaaggt caaggccctg ctgggaggga atgtccgcat gatgctgtct ggaggggccc cgctatctcc tcagacacac cgattcatga atgtctgctt ctgctgccca attggccagg gttatggact gacagaatca tgtggtgctg ggacagttac tgaagtaact gactatacta ctggcagagt tggagcacct cttatttgct gtgaaattaa gctaaaagac tggcaagaag gcggttatac aattaatgac aagccaaacc ccagaggtga aatcgtaatt ggtggacaga acatctccat gggatatttt aaaaatgaag agaaaacagc agaagattat tctgtggatg aaaatggaca aaggtggttt tgcactggtg atattggaga attccatccc gatggatgtt tacagattat agatcgtaag aaagatctag tgaagttaca agcaggagag tatgtatctc ttgggaaagt ggaagctgca ctgaagaatt gtccacttat tgacaacatc tgtgcttttg ccaaaagtga tcagtcctat gtgatcagtt ttgtggttcc taaccagaaa aggttgacac ttttggcaca acagaaaggg gtagaaggaa cttgggttga tatctgcaat aatcctgcta tggaagctga aatactgaaa gaaattcgag aagctgcaaa tgccatgaaa ttggagcgat ttgaaattcc aatcaaggtt cgattaagcc cagagccatg gacccctgaa actggtttgg taactgatgc tttcaaactg aaaaggaagg agctgaggaa ccattacctc aaagacattg aacgaatgta tgggggcaaa taa. It is sometimes possible for the material contained within the vial of "ACSL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.