ADA cDNA Clone – Homo Sapiens Adenosine Deaminase, Mrna
ADA cDNA Clone
Synonyms
ADA; N/A; ADA cDNA Clone; ADA cdna clone
Product Overview
Sequence
atggcccagacgcccgccttcgacaagcccaaagtagaactgcatgtccacctagacggatccatcaagcctgaaaccatcttatactatggcaggaggagagggatcgccctcccagctaacacagcagaggggctgctgaacgtcattggcatggacaagccgctcacccttccagacttcctggccaagtttgactactacatgcctgctatcgcgggctgccgggaggctatcaaaaggatcgcctatgagtttgtagagatgaaggccaaagagggcgtggtgtatgtggaggtgcggtacagtccgcacctgctggccaactccaaagtggagccaatcccctggaaccaggctgaaggggacctcaccccagacgaggtggtggccctagtgggccagggcctgcaggagggggagcgagacttcggggtcaaggcccggtccatcctgtgctgcatgcgccaccagcccaactggtcccccaaggtggtggagctgtgtaagaagtaccagcagcagaccgtggtagccattgacctggctggagatgagaccatcccaggaagcagcctcttgcctggacatgtccaggcctaccaggaggctgtgaagagcggcattcaccgtactgtccacgccggggaggtgggctcggccgaagtagtaaaagaggctgtggacatactcaagacagagcggctgggacacggctaccacaccctggaagaccaggccctttataacaggctgcggcaggaaaacatgcacttcgagatctgcccctggtccagctacctcactggtgcctggaagccggacacggagcatgcagtcattcggctcaaaaatgaccaggctaactactcgctcaacacagatgacccgctcatcttcaagtccaccctggacactgattaccagatgaccaaacgggacatgggctttactgaagaggagtttaaaaggctgaacatcaatgcggccaaatctagtttcctcccagaagatgaaaagagggagcttctcgacctgctctataaagcctatgggatgccaccttcagcctctgcagggcagaacctctga
Sequence Length
1092
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,764 Da
NCBI Official Full Name
Homo sapiens adenosine deaminase, mRNA
NCBI Official Synonym Full Names
adenosine deaminase
NCBI Official Symbol
ADA
NCBI Protein Information
adenosine deaminase
UniProt Protein Name
Adenosine deaminase
UniProt Gene Name
ADA
UniProt Synonym Gene Names
ADA1
UniProt Entry Name
ADA_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The ADA ada (Catalog #AAA116271) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccaga cgcccgcctt cgacaagccc aaagtagaac tgcatgtcca cctagacgga tccatcaagc ctgaaaccat cttatactat ggcaggagga gagggatcgc cctcccagct aacacagcag aggggctgct gaacgtcatt ggcatggaca agccgctcac ccttccagac ttcctggcca agtttgacta ctacatgcct gctatcgcgg gctgccggga ggctatcaaa aggatcgcct atgagtttgt agagatgaag gccaaagagg gcgtggtgta tgtggaggtg cggtacagtc cgcacctgct ggccaactcc aaagtggagc caatcccctg gaaccaggct gaaggggacc tcaccccaga cgaggtggtg gccctagtgg gccagggcct gcaggagggg gagcgagact tcggggtcaa ggcccggtcc atcctgtgct gcatgcgcca ccagcccaac tggtccccca aggtggtgga gctgtgtaag aagtaccagc agcagaccgt ggtagccatt gacctggctg gagatgagac catcccagga agcagcctct tgcctggaca tgtccaggcc taccaggagg ctgtgaagag cggcattcac cgtactgtcc acgccgggga ggtgggctcg gccgaagtag taaaagaggc tgtggacata ctcaagacag agcggctggg acacggctac cacaccctgg aagaccaggc cctttataac aggctgcggc aggaaaacat gcacttcgag atctgcccct ggtccagcta cctcactggt gcctggaagc cggacacgga gcatgcagtc attcggctca aaaatgacca ggctaactac tcgctcaaca cagatgaccc gctcatcttc aagtccaccc tggacactga ttaccagatg accaaacggg acatgggctt tactgaagag gagtttaaaa ggctgaacat caatgcggcc aaatctagtt tcctcccaga agatgaaaag agggagcttc tcgacctgct ctataaagcc tatgggatgc caccttcagc ctctgcaggg cagaacctct ga. It is sometimes possible for the material contained within the vial of "ADA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.