Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

ATP5B cdna clone

ATP5B cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
ATP5B; ATPMB; ATPSB; HEL-S-271
Synonyms
ATP5B; N/A; ATP5B cDNA Clone; ATP5B cdna clone
Ordering
Sequence
atgttggggtttgtgggtcgggtggccgctgctccggcctccggggccttgcggagactcaccccttcagcgtcgctgcccccagctcagctcttactgcgggccgctccgacggcggtccatcctgtcagggactatgcggcgcaaacatctccttcgccaaaagcaggcgccgccaccgggcgcatcgtggcggtcattggcgcagtggtggacgtccagtttgatgagggactaccaccaattctaaatgccctggaagtgcaaggcagggagaccagactggttttggaggtggcccagcatttgggtgagagcacagtaaggactattgctatggatggtacagaaggcttggttagaggccagaaagtactggattctggtgcaccaatcaaaattcctgttggtcctgagactttgggcagaatcatgaatgtcattggagaacctattgatgaaagaggtcccatcaaaaccaaacaatttgctcccattcatgctgaggctccagagttcatggaaatgagtgttgagcaggaaattctggtgactggtatcaaggttgtcgatctgctagctccctatgccaagggtggcaaaattgggctttttggtggtgctggagttggcaagactgtactgatcatggagttaatcaacaatgtcgccaaagcccatggtggttactctgtgtttgctggtgttggtgagaggacccgtgaaggcaatgatttataccatgaaatgattgaatctggtgttatcaacttaaaagatgccacctctaaggtagcgctggtatatggtcaaatgaatgaaccacctggtgctcgtgcccgggtagctctgactgggctgactgtggctgaatacttcagagaccaagaaggtcaagatgtactgctatttattgataacatctttcgcttcacccaggctggttcagaggtgtctgcattattgggccgaatcccttctgctgtgggctatcagcctaccctggccactgacatgggtactatgcaggaaagaattaccactaccaagaagggatctatcacctctgtacaggctatctatgtgcctgctgatgacttgactgaccctgcccctgctactacgtttgcccatttggatgctaccactgtactgtcgcgtgccattgctgagctgggcatctatccagctgtggatcctctagactccacctctcgtatcatggatcccaacattgttggcagtgagcattacgatgttgcccgtggggtgcaaaagatcctgcaggactacaaatccctccaggatatcattgccatcctgggtatggatgaactttctgaggaagacaagttgaccgtgtcccgtgcacggaaaatacagcgtttcttgtctcagccattccaggttgctgaggtcttcacaggtcatatggggaagctggtacccctgaaggagaccatcaaaggattccagcagattttggcaggtgaatatgaccatctcccagaacaggccttctatatggtgggacccattgaagaagctgtggcaaaagctgataagctggctgaagagcattcatcgtga
Sequence Length
1590
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
506
Molecular Weight
56,560 Da
NCBI Official Full Name
Homo sapiens ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide, mRNA
NCBI Official Synonym Full Names
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
NCBI Official Symbol
ATP5B
NCBI Official Synonym Symbols
ATPMB; ATPSB; HEL-S-271
NCBI Protein Information
ATP synthase subunit beta, mitochondrial
UniProt Protein Name
ATP synthase subunit beta, mitochondrial
UniProt Gene Name
ATP5B
UniProt Synonym Gene Names
ATPMB; ATPSB
UniProt Entry Name
ATPB_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The ATP5B atp5b (Catalog #AAA116432) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggggt ttgtgggtcg ggtggccgct gctccggcct ccggggcctt gcggagactc accccttcag cgtcgctgcc cccagctcag ctcttactgc gggccgctcc gacggcggtc catcctgtca gggactatgc ggcgcaaaca tctccttcgc caaaagcagg cgccgccacc gggcgcatcg tggcggtcat tggcgcagtg gtggacgtcc agtttgatga gggactacca ccaattctaa atgccctgga agtgcaaggc agggagacca gactggtttt ggaggtggcc cagcatttgg gtgagagcac agtaaggact attgctatgg atggtacaga aggcttggtt agaggccaga aagtactgga ttctggtgca ccaatcaaaa ttcctgttgg tcctgagact ttgggcagaa tcatgaatgt cattggagaa cctattgatg aaagaggtcc catcaaaacc aaacaatttg ctcccattca tgctgaggct ccagagttca tggaaatgag tgttgagcag gaaattctgg tgactggtat caaggttgtc gatctgctag ctccctatgc caagggtggc aaaattgggc tttttggtgg tgctggagtt ggcaagactg tactgatcat ggagttaatc aacaatgtcg ccaaagccca tggtggttac tctgtgtttg ctggtgttgg tgagaggacc cgtgaaggca atgatttata ccatgaaatg attgaatctg gtgttatcaa cttaaaagat gccacctcta aggtagcgct ggtatatggt caaatgaatg aaccacctgg tgctcgtgcc cgggtagctc tgactgggct gactgtggct gaatacttca gagaccaaga aggtcaagat gtactgctat ttattgataa catctttcgc ttcacccagg ctggttcaga ggtgtctgca ttattgggcc gaatcccttc tgctgtgggc tatcagccta ccctggccac tgacatgggt actatgcagg aaagaattac cactaccaag aagggatcta tcacctctgt acaggctatc tatgtgcctg ctgatgactt gactgaccct gcccctgcta ctacgtttgc ccatttggat gctaccactg tactgtcgcg tgccattgct gagctgggca tctatccagc tgtggatcct ctagactcca cctctcgtat catggatccc aacattgttg gcagtgagca ttacgatgtt gcccgtgggg tgcaaaagat cctgcaggac tacaaatccc tccaggatat cattgccatc ctgggtatgg atgaactttc tgaggaagac aagttgaccg tgtcccgtgc acggaaaata cagcgtttct tgtctcagcc attccaggtt gctgaggtct tcacaggtca tatggggaag ctggtacccc tgaaggagac catcaaagga ttccagcaga ttttggcagg tgaatatgac catctcccag aacaggcctt ctatatggtg ggacccattg aagaagctgt ggcaaaagct gataagctgg ctgaagagca ttcatcgtga. It is sometimes possible for the material contained within the vial of "ATP5B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.