BAG3 cDNA Clone – Homo Sapiens BCL2-Associated Athanogene 3, Mrna
BAG3 cDNA Clone
Gene Names
BAG3; BIS; BAG-3; CAIR-1
Synonyms
BAG3; N/A; BAG3 cDNA Clone; BAG3 cdna clone
Product Overview
Sequence
atgagcgccgccacccactcgcccatgatgcaggtggcgtccggcaacggtgaccgcgaccctttgccccccggatgggagatcaagatcgacccgcagaccggctggcccttcttcgtggaccacaacagccgcaccactacgtggaacgacccgcgcgtgccctctgagggccccaaggagactccatcctctgccaatggcccttcccgggagggctctaggctgccgcctgctagggaaggccaccctgtgtacccccagctccgaccaggctacattcccattcctgtgctccatgaaggcgctgagaaccggcaggtgcaccctttccatgtctatccccagcctgggatgcagcgattccgaactgaggcggcagcagcggctcctcagaggtcccagtcacctctgcggggcatgccagaaaccactcagccagataaacagtgtggacaggtggcagcggcggcggcagcccagcccccagcctcccacggacctgagcggtcccagtctccagctgcctctgactgctcatcctcatcctcctcggccagcctgccttcctccggcaggagcagcctgggcagtcaccagctcccgcgggggtacatctccattccggtgatacacgagcagaacgttacccggccagcagcccagccctccttccaccaagcccagaagacgcactacccagcgcagcagggggagtaccagacccaccagcctgtgtaccacaagatccagggggatgactgggagccccggcccctgcgggcggcatccccgttcaggtcatctgtccagggtgcatcgagccgggagggctcaccagccaggagcagcacgccactccactccccctcgcccatccgtgtgcacaccgtggtcgacaggcctcagcagcccatgacccatcgagaaactgcacctgtttcccagcctgaaaacaaaccagaaagtaagccaggcccagttggaccagaactccctcctggacacatcccaattcaagtgatccgcaaagaggtggattctaaacctgtttcccagaagcccccacctccctctgagaaggtagaggtgaaagttccccctgctccagttccttgtcctcctcccagccctggcccttctgctgtcccctcttcccccaagagtgtggctacagaagagagggcagcccccagcactgcccctgcagaagctacacctccaaaaccaggagaagccgaggctcccccaaaacatccaggagtgctgaaagtggaagccatcctggagaaggtacaggggctggagcaggctgtagacaactttgaaggcaagaagactgacaaaaagtacctgatgatcgaagagtatttgaccaaagagctgctggccctggattcagtggaccccgagggacgagccgatgtgcgtcaggccaggagagacggtgtcaggaaggttcagaccatcttggaaaaacttgaacagaaagccattgatgtcccaggtcaagtccaggtctatgaactccagcccagcaaccttgaagcagatcagccactgcaggcaatcatggagatgggtgccgtggcagcagacaagggcaagaaaaatgctggaaatgcagaagatccccacacagaaacccagcagccagaagccacagcagcagcgacttcaaaccccagcagcatgacagacacccctggtaacccagcagcaccgtag
Sequence Length
1728
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,595 Da
NCBI Official Full Name
Homo sapiens BCL2-associated athanogene 3, mRNA
NCBI Official Synonym Full Names
BCL2-associated athanogene 3
NCBI Official Symbol
BAG3
NCBI Official Synonym Symbols
BIS; BAG-3; CAIR-1
NCBI Protein Information
BAG family molecular chaperone regulator 3; docking protein CAIR-1; BCL2-binding athanogene 3; bcl-2-binding protein Bis
UniProt Protein Name
BAG family molecular chaperone regulator 3
UniProt Gene Name
BAG3
UniProt Synonym Gene Names
BIS; BAG-3
UniProt Entry Name
BAG3_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The BAG3 bag3 (Catalog #AAA116265) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgccg ccacccactc gcccatgatg caggtggcgt ccggcaacgg tgaccgcgac cctttgcccc ccggatggga gatcaagatc gacccgcaga ccggctggcc cttcttcgtg gaccacaaca gccgcaccac tacgtggaac gacccgcgcg tgccctctga gggccccaag gagactccat cctctgccaa tggcccttcc cgggagggct ctaggctgcc gcctgctagg gaaggccacc ctgtgtaccc ccagctccga ccaggctaca ttcccattcc tgtgctccat gaaggcgctg agaaccggca ggtgcaccct ttccatgtct atccccagcc tgggatgcag cgattccgaa ctgaggcggc agcagcggct cctcagaggt cccagtcacc tctgcggggc atgccagaaa ccactcagcc agataaacag tgtggacagg tggcagcggc ggcggcagcc cagcccccag cctcccacgg acctgagcgg tcccagtctc cagctgcctc tgactgctca tcctcatcct cctcggccag cctgccttcc tccggcagga gcagcctggg cagtcaccag ctcccgcggg ggtacatctc cattccggtg atacacgagc agaacgttac ccggccagca gcccagccct ccttccacca agcccagaag acgcactacc cagcgcagca gggggagtac cagacccacc agcctgtgta ccacaagatc cagggggatg actgggagcc ccggcccctg cgggcggcat ccccgttcag gtcatctgtc cagggtgcat cgagccggga gggctcacca gccaggagca gcacgccact ccactccccc tcgcccatcc gtgtgcacac cgtggtcgac aggcctcagc agcccatgac ccatcgagaa actgcacctg tttcccagcc tgaaaacaaa ccagaaagta agccaggccc agttggacca gaactccctc ctggacacat cccaattcaa gtgatccgca aagaggtgga ttctaaacct gtttcccaga agcccccacc tccctctgag aaggtagagg tgaaagttcc ccctgctcca gttccttgtc ctcctcccag ccctggccct tctgctgtcc cctcttcccc caagagtgtg gctacagaag agagggcagc ccccagcact gcccctgcag aagctacacc tccaaaacca ggagaagccg aggctccccc aaaacatcca ggagtgctga aagtggaagc catcctggag aaggtacagg ggctggagca ggctgtagac aactttgaag gcaagaagac tgacaaaaag tacctgatga tcgaagagta tttgaccaaa gagctgctgg ccctggattc agtggacccc gagggacgag ccgatgtgcg tcaggccagg agagacggtg tcaggaaggt tcagaccatc ttggaaaaac ttgaacagaa agccattgat gtcccaggtc aagtccaggt ctatgaactc cagcccagca accttgaagc agatcagcca ctgcaggcaa tcatggagat gggtgccgtg gcagcagaca agggcaagaa aaatgctgga aatgcagaag atccccacac agaaacccag cagccagaag ccacagcagc agcgacttca aaccccagca gcatgacaga cacccctggt aacccagcag caccgtag. It is sometimes possible for the material contained within the vial of "BAG3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.