Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

CCT2 cdna clone

CCT2 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
CCT2; CCTB; 99D8.1; PRO1633; CCT-beta; HEL-S-100n; TCP-1-beta
Synonyms
CCT2; N/A; CCT2 cDNA Clone; CCT2 cdna clone
Ordering
Sequence
atggcgtccctttcccttgcacctgttaacatctttaaggcaggagctgatgaagagagagcagagacagctcgtctgacttcttttattggtgccatcgccattggagacttggtaaagagcaccttgggacccaaaggcatggacaaaattcttctaagcagtggacgagatgcctctcttatggtaaccaatgatggtgccactattctaaaaaacattggtgttgacaatccagcagctaaagttttagttgatatgtcaagggttcaagatgatgaagttggtgatggcactacctctgttaccgttttagcagcagaattattaagggaagcagaatctttaattgcaaaaaagattcatccacagaccatcatagcgggttggagagaagccacgaaggctgcaagagaggcgctgttgagttctgcagttgatcatggttccgatgaagttaaattccgtcaagatttaatgaatattgcgggcacaacattatcctcaaaacttcttactcatcacaaagaccactttacaaagttagctgtagaagcagttctcagactgaaaggctctggcaacctggaggcaattcatattatcaagaagctaggaggaagtttggcagattcctatttagatgaaggcttcctgttggataaaaaaattggagtaaatcaaccaaaacgaattgaaaatgctaaaattcttattgcaaatactggtatggatacagacaaaataaagatatttggttcccgggtaagagttgactctacggcaaaggttgcagaaatagaacatgcggaaaaggaaaaaatgaaggagaaagttgaacgtattcttaagcatggaataaattgctttattaacaggcaattaatttataattatcctgaacagctctttggtgctgctggtgtcatggctattgagcatgcagattttgcaggtgtggaacgcctagctcttgtcacaggtggtgaaattgcctctacctttgatcacccagaactggtgaagcttggaagttgcaaacttatcgaggaagtcatgattggagaagacaaactcattcacttttctggggttgcccttggtgaggcttgtaccattgttttgcgtggtgccactcaacaaattttagatgaagcagaaagatcattgcatgatgctctttgtgttcttgcgcaaactgtaaaggactctagaacagtttatggaggaggctgttctgagatgttgatggctcatgctgtgacacagcttgccaatagaacaccaggcaaagaagctgttgcaatggagtcttatgctaaagcactgagaatgttgccaaccatcatagctgacaatgcaggctatgacagtgcagacctggtggcacagctcagggctgctcacagtgaaggcaataccactgctggattggatatgagggaaggcaccattggagatatggctatcctgggtataacagaaagttttcaagtgaagcgacaggttcttctgagtgcagctgaagcagcagaggtgattctgcgtgtggacaacatcatcaaagcggcacccaggaaacgtgtccctgatcaccacccctgttaa
Sequence Length
1608
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,718 Da
NCBI Official Full Name
Homo sapiens chaperonin containing TCP1, subunit 2 (beta), mRNA
NCBI Official Synonym Full Names
chaperonin containing TCP1 subunit 2
NCBI Official Symbol
CCT2
NCBI Official Synonym Symbols
CCTB; 99D8.1; PRO1633; CCT-beta; HEL-S-100n; TCP-1-beta
NCBI Protein Information
T-complex protein 1 subunit beta
UniProt Protein Name
T-complex protein 1 subunit beta
UniProt Gene Name
CCT2
UniProt Synonym Gene Names
99D8.1; CCTB; TCP-1-beta
UniProt Entry Name
TCPB_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The CCT2 cct2 (Catalog #AAA116383) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtccc tttcccttgc acctgttaac atctttaagg caggagctga tgaagagaga gcagagacag ctcgtctgac ttcttttatt ggtgccatcg ccattggaga cttggtaaag agcaccttgg gacccaaagg catggacaaa attcttctaa gcagtggacg agatgcctct cttatggtaa ccaatgatgg tgccactatt ctaaaaaaca ttggtgttga caatccagca gctaaagttt tagttgatat gtcaagggtt caagatgatg aagttggtga tggcactacc tctgttaccg ttttagcagc agaattatta agggaagcag aatctttaat tgcaaaaaag attcatccac agaccatcat agcgggttgg agagaagcca cgaaggctgc aagagaggcg ctgttgagtt ctgcagttga tcatggttcc gatgaagtta aattccgtca agatttaatg aatattgcgg gcacaacatt atcctcaaaa cttcttactc atcacaaaga ccactttaca aagttagctg tagaagcagt tctcagactg aaaggctctg gcaacctgga ggcaattcat attatcaaga agctaggagg aagtttggca gattcctatt tagatgaagg cttcctgttg gataaaaaaa ttggagtaaa tcaaccaaaa cgaattgaaa atgctaaaat tcttattgca aatactggta tggatacaga caaaataaag atatttggtt cccgggtaag agttgactct acggcaaagg ttgcagaaat agaacatgcg gaaaaggaaa aaatgaagga gaaagttgaa cgtattctta agcatggaat aaattgcttt attaacaggc aattaattta taattatcct gaacagctct ttggtgctgc tggtgtcatg gctattgagc atgcagattt tgcaggtgtg gaacgcctag ctcttgtcac aggtggtgaa attgcctcta cctttgatca cccagaactg gtgaagcttg gaagttgcaa acttatcgag gaagtcatga ttggagaaga caaactcatt cacttttctg gggttgccct tggtgaggct tgtaccattg ttttgcgtgg tgccactcaa caaattttag atgaagcaga aagatcattg catgatgctc tttgtgttct tgcgcaaact gtaaaggact ctagaacagt ttatggagga ggctgttctg agatgttgat ggctcatgct gtgacacagc ttgccaatag aacaccaggc aaagaagctg ttgcaatgga gtcttatgct aaagcactga gaatgttgcc aaccatcata gctgacaatg caggctatga cagtgcagac ctggtggcac agctcagggc tgctcacagt gaaggcaata ccactgctgg attggatatg agggaaggca ccattggaga tatggctatc ctgggtataa cagaaagttt tcaagtgaag cgacaggttc ttctgagtgc agctgaagca gcagaggtga ttctgcgtgt ggacaacatc atcaaagcgg cacccaggaa acgtgtccct gatcaccacc cctgttaa. It is sometimes possible for the material contained within the vial of "CCT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.