Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

HLA-DMA cdna clone

HLA-DMA cDNA Clone

Gene Names
HLA-DMA; DMA; HLADM; RING6; D6S222E
Synonyms
HLA-DMA; N/A; HLA-DMA cDNA Clone; HLA-DMA cdna clone
Ordering
Sequence
atgggtcatgaacagaaccaaggagctgcgctgctacagatgttaccacttctgtggctgctaccccactcctgggccgtccctgaagctcctactccaatgtggccagatgacctgcaaaaccacacattcctgcacacagtgtactgccaggatgggagtcccagtgtgggactctctgaggcctacgacgaggaccagcttttcttcttcgacttttcccagaacactcgggtgcctcgcctgcccgaatttgctgactgggctcaggaacagggagatgctcctgccattttatttgacaaagagttctgcgagtggatgatccagcaaatagggccaaaacttgatgggaaaatcccggtgtccagagggtttcctatcgctgaagtgttcacgctgaagcccctggagtttggcaagcccaacactttggtctgttttgtcagtaatctcttcccacccatgctgacagtgaactggcagcatcattccgtccctgtggaaggatttgggcctacttttgtctcagctgtcgatggactcagcttccaggccttttcttacttaaacttcacaccagaaccttctgacattttctcctgcattgtgactcacgaaattgaccgctacacagcaattgcctattgggtaccccggaacgcactgccctcagatctgctggagaatgtgctgtgtggcgtggcctttggcctgggtgtgctgggcatcatcgtgggcattgttctcatcatctacttccggaagccttgctcaggtgactga
Sequence Length
786
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,194 Da
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class II, DM alpha, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class II, DM alpha
NCBI Official Symbol
HLA-DMA
NCBI Official Synonym Symbols
DMA; HLADM; RING6; D6S222E
NCBI Protein Information
HLA class II histocompatibility antigen, DM alpha chain
UniProt Protein Name
HLA class II histocompatibility antigen, DM alpha chain
UniProt Gene Name
HLA-DMA
UniProt Synonym Gene Names
DMA; RING6
UniProt Entry Name
DMA_HUMAN

Similar Products

Product Notes

The HLA-DMA hla-dma (Catalog #AAA116418) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcatg aacagaacca aggagctgcg ctgctacaga tgttaccact tctgtggctg ctaccccact cctgggccgt ccctgaagct cctactccaa tgtggccaga tgacctgcaa aaccacacat tcctgcacac agtgtactgc caggatggga gtcccagtgt gggactctct gaggcctacg acgaggacca gcttttcttc ttcgactttt cccagaacac tcgggtgcct cgcctgcccg aatttgctga ctgggctcag gaacagggag atgctcctgc cattttattt gacaaagagt tctgcgagtg gatgatccag caaatagggc caaaacttga tgggaaaatc ccggtgtcca gagggtttcc tatcgctgaa gtgttcacgc tgaagcccct ggagtttggc aagcccaaca ctttggtctg ttttgtcagt aatctcttcc cacccatgct gacagtgaac tggcagcatc attccgtccc tgtggaagga tttgggccta cttttgtctc agctgtcgat ggactcagct tccaggcctt ttcttactta aacttcacac cagaaccttc tgacattttc tcctgcattg tgactcacga aattgaccgc tacacagcaa ttgcctattg ggtaccccgg aacgcactgc cctcagatct gctggagaat gtgctgtgtg gcgtggcctt tggcctgggt gtgctgggca tcatcgtggg cattgttctc atcatctact tccggaagcc ttgctcaggt gactga. It is sometimes possible for the material contained within the vial of "HLA-DMA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.