Sequence
ATGTCTTGGAAGATGGCTCTGCAGATCCCTGGAGGCTTTTGGGCAGCAGCTGTGACCGTGATGCTGGTGATGCTGAGCACCCCAGTGGCTGAGGCCAGAGACTTTCCCAAGGATTTCTTGGTCCAGTTTAAGGGCATGTGCTACTTCACCAACGGGACAGAGCGCGTGCGGGGTGTGGCCAGATACATCTATAACCGCGAGGAGTACGGGCGCTTCGACAGCGACGTTGGGGAGTTCCAGGCGGTGACCGAGCTGGGGCGGAGCATCGAGGACTGGAACAACTATAAGGACTTCTTGGAGCAGGAGCGGGCCGCGGTGGACAAGGTGTGCAGACACAACTACGAGGCGGAGCTACGCACGACCTTGCAGCGGCAAGTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAGAGGCCCTCAACCACCACAACCTGCTGGTCTGCTCAGTGACAGATTTCTATCCAGCCCAGATCAAAGTCCAGTGGTTTCGGAATGACCAGGAGGAGACAGCCGGTGTTGTGTCCACCTCCCTCATTAGGAATGGTGACTGGACCTTCCAGATTCTGGTGATGCTGGAAATAACTCCCCAGCGTGGAGACATCTACACCTGCCAAGTGGAGCACCCCAGCCTCCAGAGCCCCATCACCGTGGAGTGGCGACCTCGAGGGCCTCCACCTGCAGGACTCCTGCACTGA
cDNA Size
696 bp
Definition
Homo sapiens major histocompatibility complex, class II, DQ beta 2,mRNA (cDNA clone IMAGE: 4747201).
Recombination site
attL1, attL2
Vector
pENTR223.1 (spectinomycin)
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class II, DQ beta 2, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class II, DQ beta 2
NCBI Official Symbol
HLA-DQB2
NCBI Official Synonym Symbols
HLA-DXB; HLA-DQB1
NCBI Protein Information
HLA class II histocompatibility antigen, DQ beta 2 chain
UniProt Protein Name
HLA class II histocompatibility antigen, DQ beta 2 chain
UniProt Gene Name
HLA-DQB2
UniProt Synonym Gene Names
HLA-DXB
UniProt Entry Name
DQB2_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The HLA-DQB2 hla-dqb2 (Catalog #AAA116220) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTCTTGGA AGATGGCTCT GCAGATCCCT GGAGGCTTTT GGGCAGCAGC TGTGACCGTG ATGCTGGTGA TGCTGAGCAC CCCAGTGGCT GAGGCCAGAG ACTTTCCCAA GGATTTCTTG GTCCAGTTTA AGGGCATGTG CTACTTCACC AACGGGACAG AGCGCGTGCG GGGTGTGGCC AGATACATCT ATAACCGCGA GGAGTACGGG CGCTTCGACA GCGACGTTGG GGAGTTCCAG GCGGTGACCG AGCTGGGGCG GAGCATCGAG GACTGGAACA ACTATAAGGA CTTCTTGGAG CAGGAGCGGG CCGCGGTGGA CAAGGTGTGC AGACACAACT ACGAGGCGGA GCTACGCACG ACCTTGCAGC GGCAAGTGGA GCCCACAGTG ACCATCTCCC CATCCAGGAC AGAGGCCCTC AACCACCACA ACCTGCTGGT CTGCTCAGTG ACAGATTTCT ATCCAGCCCA GATCAAAGTC CAGTGGTTTC GGAATGACCA GGAGGAGACA GCCGGTGTTG TGTCCACCTC CCTCATTAGG AATGGTGACT GGACCTTCCA GATTCTGGTG ATGCTGGAAA TAACTCCCCA GCGTGGAGAC ATCTACACCT GCCAAGTGGA GCACCCCAGC CTCCAGAGCC CCATCACCGT GGAGTGGCGA CCTCGAGGGC CTCCACCTGC AGGACTCCTG CACTGA. It is sometimes possible for the material contained within the vial of "HLA-DQB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
