ISCU cDNA Clone – Homo Sapiens Iron-Sulfur Cluster Scaffold Homolog (E. Coli), Mrna
ISCU cDNA Clone
Gene Names
ISCU; HML; ISU2; NIFU; NIFUN; hnifU; 2310020H20Rik
Synonyms
ISCU; N/A; ISCU cDNA Clone; ISCU cdna clone
Product Overview
Sequence
atggcggcggctggggctttccgtctgaggcgggcggcatcggctctgctgctgcggagcccccgcctgcccgcccgggagctgtcggccccggcccgactctatcacaagaaggttgttgatcattatgaaaatcctagaaacgtggggtcccttgacaagacatctaaaaatgttggaactggactggtgggggctccagcatgtggtgacgtaatgaaattacagattcaagtggatgaaaaggggaagattgtggatgctaggtttaaaacatttggctgtggttccgcaattgcctccagctcattagccactgaatgggtgaaaggaaagacggtggaggaagccttgactatcaaaaacacagatatcgccaaggagctctgccttcctcccgtgaaactgcactgctccatgctggctgaagatgcaatcaaggccgccctggctgattacaaattgaaacaagaacccaaaaaaggagaggcagagaagaaatga
Sequence Length
504
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,999 Da
NCBI Official Full Name
Homo sapiens iron-sulfur cluster scaffold homolog (E. coli), mRNA
NCBI Official Synonym Full Names
iron-sulfur cluster scaffold homolog (E. coli)
NCBI Official Symbol
ISCU
NCBI Official Synonym Symbols
HML; ISU2; NIFU; NIFUN; hnifU; 2310020H20Rik
NCBI Protein Information
iron-sulfur cluster assembly enzyme ISCU, mitochondrial; nifU-like protein; NifU-like N-terminal domain containing; IscU iron-sulfur cluster scaffold homolog; nifU-like N-terminal domain-containing protein
UniProt Protein Name
Iron-sulfur cluster assembly enzyme ISCU, mitochondrial
UniProt Gene Name
ISCU
UniProt Synonym Gene Names
NIFUN
UniProt Entry Name
ISCU_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Additional Details
Product Notes
The ISCU iscu (Catalog #AAA116302) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg ctggggcttt ccgtctgagg cgggcggcat cggctctgct gctgcggagc ccccgcctgc ccgcccggga gctgtcggcc ccggcccgac tctatcacaa gaaggttgtt gatcattatg aaaatcctag aaacgtgggg tcccttgaca agacatctaa aaatgttgga actggactgg tgggggctcc agcatgtggt gacgtaatga aattacagat tcaagtggat gaaaagggga agattgtgga tgctaggttt aaaacatttg gctgtggttc cgcaattgcc tccagctcat tagccactga atgggtgaaa ggaaagacgg tggaggaagc cttgactatc aaaaacacag atatcgccaa ggagctctgc cttcctcccg tgaaactgca ctgctccatg ctggctgaag atgcaatcaa ggccgccctg gctgattaca aattgaaaca agaacccaaa aaaggagagg cagagaagaa atga. It is sometimes possible for the material contained within the vial of "ISCU, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.