MDM4 cdna clone
MDM4 cDNA Clone
Gene Names
MDM4; HDMX; MDMX; MRP1
Synonyms
MDM4; N/A; MDM4 cDNA Clone; MDM4 cdna clone
Sequence
atgacatcattttccacctctgctcagtgttcaacatctgacagtgcttgcaggatctctcctggacaaatcaatcaggtacgaccaaaactgccgcttttgaagattttgcatgcagcaggtgcgcaaggtgaaatgttcactgttaaagaggtcatgcactatttaggtcagtacataatggtgaagcaactttatgatcagcaggagcagcatatggtatattgtggtggagatcttttgggagaactactgggacgtcagagcttctccgtgaaagacccaagccctctctatgatatgctaagaaagaatcttgtcactttagccactgctactacagatgctgctcagactctcgctctcgcacaggatcacagtatggatattccaagtcaagaccaactgaagcaaagtgcagaggaaagttccacttccagaaaaagaactacagaagacgatatccccacactgcctacctcagagcataaatgcatacattctagagaagatgaagacttaattgaaaatttagcccaagatgaaacatctaggctggaccttggatttgaggagtgggatgtagctggcctgccttggtggtttttaggaaacttgagaagcaactatacacctagaagtaatggctcaactgatttacagacaaatcaggatgtgggtactgccattgtttcagatactacagatgacttgtggtttttgaatgagtcagtatcagagcagttaggtgttggaataaaagttgaagctgctgatactgaacaaacaagtgaagaagtagggaaagtaagtgacaaaaaggtgattgaagtgggaaaaaatgatgacctggaggactctaagtccttaagtgatgataccgatgtagaggttacctctgaggatgagtggcagtgtactgaatgcaagaaatttaactctccaagcaagaggtactgttttcgttgttgggccttgaggaaggattggtattcagattgttcaaagttaacccattctctctccacgtctgatatcactgccatacctgaaaaggaaaatgaaggaaatgatgtccctgattgtcgaagaaccatttcggctcctgtcgttagacctaaagatgcgtatataaagaaagaaaactccaaactttttgatccctgcaactcagtggaattcttggatttggctcacagttctgaaagccaagagaccatctcaagcatgggagaacagttagataacctttctgaacagagaacagatacagaaaacatggaggattgccagaatctcttgaagccatgtagcttatgtgagaaaagaccacgagacgggaacattattcatggaaggacgggccatcttgtcacttgttttcactgtgccagaagactaaagaaggctggggcttcatgccctatttgcaagaaagagattcagctggttattaaggtttttatagcataa
Sequence Length
1473
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,541 Da
NCBI Official Full Name
Homo sapiens Mdm4 p53 binding protein homolog (mouse), mRNA
NCBI Official Synonym Full Names
MDM4, p53 regulator
NCBI Official Symbol
MDM4
NCBI Official Synonym Symbols
HDMX; MDMX; MRP1
NCBI Protein Information
protein Mdm4
UniProt Protein Name
Protein Mdm4
UniProt Gene Name
MDM4
UniProt Synonym Gene Names
MDMX
UniProt Entry Name
MDM4_HUMAN
Similar Products
Product Notes
The MDM4 mdm4 (Catalog #AAA116403) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacatcat tttccacctc tgctcagtgt tcaacatctg acagtgcttg caggatctct cctggacaaa tcaatcaggt acgaccaaaa ctgccgcttt tgaagatttt gcatgcagca ggtgcgcaag gtgaaatgtt cactgttaaa gaggtcatgc actatttagg tcagtacata atggtgaagc aactttatga tcagcaggag cagcatatgg tatattgtgg tggagatctt ttgggagaac tactgggacg tcagagcttc tccgtgaaag acccaagccc tctctatgat atgctaagaa agaatcttgt cactttagcc actgctacta cagatgctgc tcagactctc gctctcgcac aggatcacag tatggatatt ccaagtcaag accaactgaa gcaaagtgca gaggaaagtt ccacttccag aaaaagaact acagaagacg atatccccac actgcctacc tcagagcata aatgcataca ttctagagaa gatgaagact taattgaaaa tttagcccaa gatgaaacat ctaggctgga ccttggattt gaggagtggg atgtagctgg cctgccttgg tggtttttag gaaacttgag aagcaactat acacctagaa gtaatggctc aactgattta cagacaaatc aggatgtggg tactgccatt gtttcagata ctacagatga cttgtggttt ttgaatgagt cagtatcaga gcagttaggt gttggaataa aagttgaagc tgctgatact gaacaaacaa gtgaagaagt agggaaagta agtgacaaaa aggtgattga agtgggaaaa aatgatgacc tggaggactc taagtcctta agtgatgata ccgatgtaga ggttacctct gaggatgagt ggcagtgtac tgaatgcaag aaatttaact ctccaagcaa gaggtactgt tttcgttgtt gggccttgag gaaggattgg tattcagatt gttcaaagtt aacccattct ctctccacgt ctgatatcac tgccatacct gaaaaggaaa atgaaggaaa tgatgtccct gattgtcgaa gaaccatttc ggctcctgtc gttagaccta aagatgcgta tataaagaaa gaaaactcca aactttttga tccctgcaac tcagtggaat tcttggattt ggctcacagt tctgaaagcc aagagaccat ctcaagcatg ggagaacagt tagataacct ttctgaacag agaacagata cagaaaacat ggaggattgc cagaatctct tgaagccatg tagcttatgt gagaaaagac cacgagacgg gaacattatt catggaagga cgggccatct tgtcacttgt tttcactgtg ccagaagact aaagaaggct ggggcttcat gccctatttg caagaaagag attcagctgg ttattaaggt ttttatagca taa. It is sometimes possible for the material contained within the vial of "MDM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.