TRPV6 cdna clone
TRPV6 cDNA Clone
Gene Names
TRPV6; CAT1; CATL; ZFAB; ECAC2; ABP/ZF; LP6728; HSA277909
Synonyms
TRPV6; N/A; TRPV6 cDNA Clone; TRPV6 cdna clone
Sequence
atgtacgttgagaatcactgctccaggcctgcattactccttcagctctggggcagaggaagcccagcccaagcacggggctggcagggcgtgaggaactctcctgtggcctgctcatcacccttccgacaggagcactgcatgtcagagcactttaaaaacaggccagcctgcttgggcgctcggtctccaccccagggtcataagtggggagagagcccttcccagggcacccaggcaggtgcagggaagtgcagagcttgtggaaagcgtgtgagtgagggagacaggaacggctctgggggtgggaagtggggctag
Sequence Length
321
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
68,446 Da
NCBI Official Full Name
Homo sapiens transient receptor potential cation channel, subfamily V, member 6, mRNA
NCBI Official Synonym Full Names
transient receptor potential cation channel subfamily V member 6
NCBI Official Symbol
TRPV6
NCBI Official Synonym Symbols
CAT1; CATL; ZFAB; ECAC2; ABP/ZF; LP6728; HSA277909
NCBI Protein Information
transient receptor potential cation channel subfamily V member 6
UniProt Protein Name
Transient receptor potential cation channel subfamily V member 6
UniProt Gene Name
TRPV6
UniProt Synonym Gene Names
ECAC2; TrpV6; CaT-L; CaT1; ECaC2
UniProt Entry Name
TRPV6_HUMAN
Similar Products
Product Notes
The TRPV6 trpv6 (Catalog #AAA116373) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacgttg agaatcactg ctccaggcct gcattactcc ttcagctctg gggcagagga agcccagccc aagcacgggg ctggcagggc gtgaggaact ctcctgtggc ctgctcatca cccttccgac aggagcactg catgtcagag cactttaaaa acaggccagc ctgcttgggc gctcggtctc caccccaggg tcataagtgg ggagagagcc cttcccaggg cacccaggca ggtgcaggga agtgcagagc ttgtggaaag cgtgtgagtg agggagacag gaacggctct gggggtggga agtggggcta g. It is sometimes possible for the material contained within the vial of "TRPV6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.