Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us

XPNPEP1 cdna clone

XPNPEP1 cDNA Clone

Average rating 0.0
No ratings yet
Gene Names
XPNPEP1; APP1; SAMP; XPNPEP; XPNPEPL; XPNPEPL1
Synonyms
XPNPEP1; N/A; XPNPEP1 cDNA Clone; XPNPEP1 cdna clone
Ordering
Sequence
atgcctccaaaggtgacttcagagctgcttcggcagctgagacaagccatgaggaactctgagtatgtgaccgaaccgatccaggcctacatcatcccatcgggagatgctcatcagagtgagtatattgctccatgtgactgtcggcgggcttttgtctctggattcgatggctctgcgggcacagccatcatcacagaagagcatgcagccatgtggactgacgggcgctactttctccaggctgccaagcaaatggacagcaactggacacttatgaagatgggtctgaaggacacaccaactcaggaagactggctggtgagtgtgcttcctgaaggatccagggttggtgtggaccccttgatcattcctacagattattggaagaaaatggccaaagttctgagaagtgccggccatcacctcattcctgtcaaggagaacctcgttgacaaaatctggacagaccgtcctgagcgcccttgcaagcctctcctcacactgggcctggattacacaggcatctcctggaaggacaaggttgcagaccttcggttgaaaatggctgagaggaacgtcatgtggtttgtggtcactgccttggatgagattgcgtggctatttaatctccgaggatcagatgtggagcacaatccagtatttttctcctacgcaatcataggactagagacgatcatgctcttcattgatggtgaccgcatagacgcccccagtgtgaaggagcacctgcttcttgacttgggtctggaagccgaatacaggatccaggtgcatccctacaagtccatcctgagcgagctcaaggccctgtgtgctgacctctccccaagggagaaggtgtgggtcagtgacaaggccagctatgctgtgagcgagaccatccccaaggaccaccgctgctgtatgccttacacccccatctgcatcgccaaagctgtgaagaattcagctgagtcagaaggcatgaggcgggctcacattaaagatgctgttgctctctgtgaactctttaactggctggagaaagaggttcccaaaggtggtgtgacagagatctcagctgctgacaaagctgaggagtttcgcaggcaacaggcagactttgtggacctgagcttcccaacaatttccagtacgggacccaacggcgccatcattcactacgcgccagtccctgagacgaataggaccttgtccctggatgaggtgtaccttattgactcgggtgctcaatacaaggatggcaccacagatgtgacgcggacaatgcattttgggacccctacagcctacgagaaggaatgcttcacatatgtcctcaagggccacatagctgtgagtgcagccgttttcccgactggaaccaaaggtcaccttcttgactcctttgcccgttcagctttatgggattcaggcctagattacttgcacgggactggacatggtgttgggtcttttttgaatgtccatgagggtccttgcggcatcagttacaaaacattctctgatgagcccttggaggcaggcatgattgtcactgatgagcccgggtactatgaagatggggcttttggaattcgcattgagaatgttgtccttgtggttcctgtgaagaccaagtataattttaataaccggggaagcctgacctttgaacctctaacattggttccaattcagaccaaaatgatagatgtggattctcttacagacaaagagtgcgactggctcaacaattaccacctgacctgcagggatgtgattgggaaggaattgcagaaacagggccgccaggaagctctcgagtggctcatcagagagacgcaacccatctccaaacagcattaa
Sequence Length
1872
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,107 Da
NCBI Official Full Name
Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 1, soluble, mRNA
NCBI Official Synonym Full Names
X-prolyl aminopeptidase 1
NCBI Official Symbol
XPNPEP1
NCBI Official Synonym Symbols
APP1; SAMP; XPNPEP; XPNPEPL; XPNPEPL1
NCBI Protein Information
xaa-Pro aminopeptidase 1
UniProt Protein Name
Xaa-Pro aminopeptidase 1
UniProt Gene Name
XPNPEP1
UniProt Synonym Gene Names
sAmp
UniProt Entry Name
XPP1_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The XPNPEP1 xpnpep1 (Catalog #AAA116334) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctccaa aggtgacttc agagctgctt cggcagctga gacaagccat gaggaactct gagtatgtga ccgaaccgat ccaggcctac atcatcccat cgggagatgc tcatcagagt gagtatattg ctccatgtga ctgtcggcgg gcttttgtct ctggattcga tggctctgcg ggcacagcca tcatcacaga agagcatgca gccatgtgga ctgacgggcg ctactttctc caggctgcca agcaaatgga cagcaactgg acacttatga agatgggtct gaaggacaca ccaactcagg aagactggct ggtgagtgtg cttcctgaag gatccagggt tggtgtggac cccttgatca ttcctacaga ttattggaag aaaatggcca aagttctgag aagtgccggc catcacctca ttcctgtcaa ggagaacctc gttgacaaaa tctggacaga ccgtcctgag cgcccttgca agcctctcct cacactgggc ctggattaca caggcatctc ctggaaggac aaggttgcag accttcggtt gaaaatggct gagaggaacg tcatgtggtt tgtggtcact gccttggatg agattgcgtg gctatttaat ctccgaggat cagatgtgga gcacaatcca gtatttttct cctacgcaat cataggacta gagacgatca tgctcttcat tgatggtgac cgcatagacg cccccagtgt gaaggagcac ctgcttcttg acttgggtct ggaagccgaa tacaggatcc aggtgcatcc ctacaagtcc atcctgagcg agctcaaggc cctgtgtgct gacctctccc caagggagaa ggtgtgggtc agtgacaagg ccagctatgc tgtgagcgag accatcccca aggaccaccg ctgctgtatg ccttacaccc ccatctgcat cgccaaagct gtgaagaatt cagctgagtc agaaggcatg aggcgggctc acattaaaga tgctgttgct ctctgtgaac tctttaactg gctggagaaa gaggttccca aaggtggtgt gacagagatc tcagctgctg acaaagctga ggagtttcgc aggcaacagg cagactttgt ggacctgagc ttcccaacaa tttccagtac gggacccaac ggcgccatca ttcactacgc gccagtccct gagacgaata ggaccttgtc cctggatgag gtgtacctta ttgactcggg tgctcaatac aaggatggca ccacagatgt gacgcggaca atgcattttg ggacccctac agcctacgag aaggaatgct tcacatatgt cctcaagggc cacatagctg tgagtgcagc cgttttcccg actggaacca aaggtcacct tcttgactcc tttgcccgtt cagctttatg ggattcaggc ctagattact tgcacgggac tggacatggt gttgggtctt ttttgaatgt ccatgagggt ccttgcggca tcagttacaa aacattctct gatgagccct tggaggcagg catgattgtc actgatgagc ccgggtacta tgaagatggg gcttttggaa ttcgcattga gaatgttgtc cttgtggttc ctgtgaagac caagtataat tttaataacc ggggaagcct gacctttgaa cctctaacat tggttccaat tcagaccaaa atgatagatg tggattctct tacagacaaa gagtgcgact ggctcaacaa ttaccacctg acctgcaggg atgtgattgg gaaggaattg cagaaacagg gccgccagga agctctcgag tggctcatca gagagacgca acccatctcc aaacagcatt aa. It is sometimes possible for the material contained within the vial of "XPNPEP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.