Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us
product-image-AAA59755_AD11.jpg Application Data (MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)

METTL3/METTL14 recombinant protein

Recombinant METTL3/METTL14 complex

Average rating 0.0
No ratings yet
Gene Names
METTL3; M6A; IME4; Spo8; MT-A70
Synonyms
METTL3/METTL14; N/A; Recombinant METTL3/METTL14 complex; Methyltransferase Like 3; MRNA M(6)A Methyltransferase; N6-Adenosine-Methyltransferase; METTL3/METTL14 recombinant protein
Ordering
Host
Baculovirus
Form/Format
Recombinant METTL3/METTL14 complex is supplied in 25mM HEPES-NaOH pH7.5, 300mM NaCl, 10% glycerol, 0.04% Triton X-100, and 0.5mM TCEP.
Protein Species
Human
Tag
DYKDDDDK-Tag
Notes
This product was manufactured as described in Protein Details. Where possible, We has developed functional or activity assays for recombinant proteins. Additional characterization such as enzyme kinetic activity assays, inhibitor screening or other biological activity assays may not have been performed for every product. All available data for a given product is shown on the lot-specific Technical Data Sheet.
Dry Ice Shipment
Extra charge fee may add to your shipping cost as dry ice is required to ship this product.
Preparation and Storage
Recombinant proteins in solution are temperature sensitive and must be stored at -80 degree C to prevent degradation. Avoid repeated freeze/thaw cycles and keep on ice when not in storage.
Shipping Temp: Dry Ice

Application Data

(MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)

product-image-AAA59755_AD11.jpg Application Data (MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)

Application Data

(MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)

product-image-AAA59755_AD13.jpg Application Data (MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)

SDS-PAGE

(Recombinant METTL3 / METTL14 complex, protein gel. Recombinant METTL3 / METTL14 complex was run on a 10% SDS-PAGE gel and stained with Coomassie Blue. MW: METTL3: 64.5 kDa, MW: METTL14, N-DYKDDDDK: 53.3 kDa. Purity: >85%)

product-image-AAA59755_SDS_PAGE15.jpg SDS-PAGE (Recombinant METTL3 / METTL14 complex, protein gel. Recombinant METTL3 / METTL14 complex was run on a 10% SDS-PAGE gel and stained with Coomassie Blue. MW: METTL3: 64.5 kDa, MW: METTL14, N-DYKDDDDK: 53.3 kDa. Purity: >85%)
Related Product Information for METTL3/METTL14 recombinant protein
Short Description: Recombinant METTL3/METTL14 complex that includes full-length human METTL3 (accession number NP_062826.2) without tag and full-length METTL14 protein (accession number NP_066012.1) with an N-terminal DYKDDDDK-Tag was expressed in Sf9 cells. The molecular weights of METTL3 and METTL14 are 64.5 kDa and 53.3 kDa, respectively. It is suitable for analysis of RNA methylation and modification, RNA splicing, processing and transcription regulation assays.

Background: N6-methylated adenine (m6A) is prevalently present in nearly all RNA types and can be found in all organisms from bacteria to humans. It preferentially appears around stop codons and within long internal exons in mammalian messager RNAs. m6A plays an important role in the efficiency of mRNA splicing, processing, translation efficiency, editing and mRNA stability. m6A also takes place in other RNA molecules, such as primary miRNA (pri-miRNAs). In mammalian cells, METTL3 (methyltransferase-like 3, also known as IME4, M6A, MT-A70) and METTL14 (methyltransferase-like 14) are two m6A methyltransferases reported to date, which both contain methyltransferase domains. These two proteins form a stable heterodimer core complex of METTL3-METTL14 that functions in cellular m6A deposition on mammalian nuclear RNAs. METTL3 is the catalytically active subunit, while METTL14 plays a structural role critical for substrate recognition.
Product Categories/Family for METTL3/METTL14 recombinant protein

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
Molecular Weight
25,479 Da
NCBI Official Full Name
N6-adenosine-methyltransferase 70 kDa subunit
NCBI Official Synonym Full Names
methyltransferase like 3
NCBI Official Symbol
METTL3
NCBI Official Synonym Symbols
M6A; IME4; Spo8; MT-A70
NCBI Protein Information
N6-adenosine-methyltransferase 70 kDa subunit; mRNA m(6)A methyltransferase; methyltransferase-like protein 3; adoMet-binding subunit of the human mRNA (N6-adenosine)-methyltransferase
UniProt Protein Name
N6-adenosine-methyltransferase 70 kDa subunit
UniProt Gene Name
METTL3
UniProt Synonym Gene Names
MTA70; MT-A70
UniProt Entry Name
MTA70_HUMAN

Customer Reviews

View All Reviews

Loading reviews...

Share Your Experience

Rating

Similar Products

Product Notes

The METTL3/METTL14 mettl3 (Catalog #AAA59755) is a Recombinant Protein produced from Baculovirus and is intended for research purposes only. The product is available for immediate purchase. It is sometimes possible for the material contained within the vial of "METTL3/METTL14, Recombinant Protein" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.