METTL3/METTL14 recombinant protein
Recombinant METTL3/METTL14 complex
Shipping Temp: Dry Ice
Application Data
(MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)
Application Data
(MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)
SDS-PAGE
(Recombinant METTL3 / METTL14 complex, protein gel. Recombinant METTL3 / METTL14 complex was run on a 10% SDS-PAGE gel and stained with Coomassie Blue. MW: METTL3: 64.5 kDa, MW: METTL14, N-DYKDDDDK: 53.3 kDa. Purity: >85%)
Background: N6-methylated adenine (m6A) is prevalently present in nearly all RNA types and can be found in all organisms from bacteria to humans. It preferentially appears around stop codons and within long internal exons in mammalian messager RNAs. m6A plays an important role in the efficiency of mRNA splicing, processing, translation efficiency, editing and mRNA stability. m6A also takes place in other RNA molecules, such as primary miRNA (pri-miRNAs). In mammalian cells, METTL3 (methyltransferase-like 3, also known as IME4, M6A, MT-A70) and METTL14 (methyltransferase-like 14) are two m6A methyltransferases reported to date, which both contain methyltransferase domains. These two proteins form a stable heterodimer core complex of METTL3-METTL14 that functions in cellular m6A deposition on mammalian nuclear RNAs. METTL3 is the catalytically active subunit, while METTL14 plays a structural role critical for substrate recognition.
NCBI and Uniprot Product Information
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The METTL3/METTL14 mettl3 (Catalog #AAA59755) is a Recombinant Protein produced from Baculovirus and is intended for research purposes only. The product is available for immediate purchase. It is sometimes possible for the material contained within the vial of "METTL3/METTL14, Recombinant Protein" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
