Loading...

Skip to main content
Call us at +1-800-604-9114 for more information about our products or contact us online Need help? +1-800-604-9114 or contact us
product-image-AAA30800_APP8.png Application Data (He. Fenglian. et al. "Synergistic effect of Notch-3-specific inhibition and paclitaxel in non-small cell lung cancer (NSCLC) cells via activation of the intrinsic apoptosis pathway." Medical science monitor: international medical journal of experimental and clinical research 23 (2017): 3760.)

Mouse BCL-2 Monoclonal Antibody | anti-BCL-2 antibody

BCL-2 (PTR2303) Monoclonal Antibody

Gene Names
BCL2; Bcl-2; PPP1R50
Reactivity
Human, Mouse, Rat
Applications
Immunofluorescence, Immunocytochemistry, Western Blot, Immunohistochemistry
Purity
Protein G
Synonyms
BCL-2, Antibody; BCL-2 (PTR2303) Monoclonal Antibody; Apoptosis regulator Bcl-2; BCL2; anti-BCL-2 antibody
Ordering
For Research Use Only!
Host
Mouse
Reactivity
Human, Mouse, Rat
Clonality
Monoclonal
Isotype
Mouse IgG2b, Kappa
Clone Number
PTR2303
Specificity
This antibody detects endogenous levels of BCL-2 protein.
Purity/Purification
Protein G
Form/Format
PBS, 50% glycerol, 0.05% Proclin 300, 0.05%BSA
Applicable Applications for anti-BCL-2 antibody
IF (Immunofluorescence), ICC (Immunocytochemistry), WB (Western Blot), IHC (Immunohistochemistry)
Application Notes
WB: 1:500-2000
IF: 1:100-500
ELISA: 1:1000-5000
Immunogen
Synthetic Peptide of Bcl-2
Modification
Unmodified/Total
Preparation and Storage
Store at -20 degree C/1 year

Application Data

(He. Fenglian. et al. "Synergistic effect of Notch-3-specific inhibition and paclitaxel in non-small cell lung cancer (NSCLC) cells via activation of the intrinsic apoptosis pathway." Medical science monitor: international medical journal of experimental and clinical research 23 (2017): 3760.)

product-image-AAA30800_APP8.png Application Data (He. Fenglian. et al. "Synergistic effect of Notch-3-specific inhibition and paclitaxel in non-small cell lung cancer (NSCLC) cells via activation of the intrinsic apoptosis pathway." Medical science monitor: international medical journal of experimental and clinical research 23 (2017): 3760.)

WB (Western Blot)

(Western blot detection of Bcl-2 in human breast cancer cell line MCF-7(A). MDA-MB-231(B) and Cal51(C) using Bcl-2 mouse mAb (AAA30800. 1:2000 diluted).Predicted band size: 26kDa.Observed band size:26kDa. Picture was kindly provided by our customer from Tianjin Medical University Cancer Institute and Hospital)

product-image-AAA30800_WB7.png WB (Western Blot) (Western blot detection of Bcl-2 in human breast cancer cell line MCF-7(A). MDA-MB-231(B) and Cal51(C) using Bcl-2 mouse mAb (AAA30800. 1:2000 diluted).Predicted band size: 26kDa.Observed band size:26kDa. Picture was kindly provided by our customer from Tianjin Medical University Cancer Institute and Hospital)

WB (Western Blot)

(Western blot analysis of lysates from 1)Hela. 2) MCF-7 cells. (Green) primary antibody was diluted at 1:1000. 4 degree over night. secondary antibody(Assay Biotech:SA0438)was diluted at 1:10000. 37 degree 1hour. (Red) Actin ? Polyclonal Antibody (Assay Biotech:C40022) antibody was diluted at 1:5000 as loading control. 4 degree over night.Dylight 680 secondary antibody(Assay Biotech:SA0437)was diluted at 1:10000. 37 degree 1hour.)

product-image-AAA30800_WB6.png WB (Western Blot) (Western blot analysis of lysates from 1)Hela. 2) MCF-7 cells. (Green) primary antibody was diluted at 1:1000. 4 degree over night. secondary antibody(Assay Biotech:SA0438)was diluted at 1:10000. 37 degree 1hour. (Red) Actin ? Polyclonal Antibody (Assay Biotech:C40022) antibody was diluted at 1:5000 as loading control. 4 degree over night.Dylight 680 secondary antibody(Assay Biotech:SA0437)was diluted at 1:10000. 37 degree 1hour.)

WB (Western Blot)

(Western blot analysis of lysates from 1)Hela cell. 2)Hela cells knockdown by siRNA1 (F:GGAUGACUGAGUACCUGAATT.R:UUCAGGUACUCAGUCAUCCTT) siRNA2(F:GUGAUGAAGUACAUCCAUUAU.R:AUAAUGGAUGUACUUCAUCAC). (Green) primary antibody was diluted at 1:1000. 4 degree over night. Dylight 800 secondary antibody(Assay Biotech:SA0438)was diluted at 1:10000. 37 degree 1hour. (Red) GAPDH rabbit (Assay Biotech:C40021) antibody was diluted at 1:5000 as loading control. 4 degree over night. Dylight 680 secondary antibody(Assay Biotech:SA0437)was diluted at 1:10000. 37 degree 1hour.)

product-image-AAA30800_WB5.png WB (Western Blot) (Western blot analysis of lysates from 1)Hela cell. 2)Hela cells knockdown by siRNA1 (F:GGAUGACUGAGUACCUGAATT.R:UUCAGGUACUCAGUCAUCCTT) siRNA2(F:GUGAUGAAGUACAUCCAUUAU.R:AUAAUGGAUGUACUUCAUCAC). (Green) primary antibody was diluted at 1:1000. 4 degree over night. Dylight 800 secondary antibody(Assay Biotech:SA0438)was diluted at 1:10000. 37 degree 1hour. (Red) GAPDH rabbit (Assay Biotech:C40021) antibody was diluted at 1:5000 as loading control. 4 degree over night. Dylight 680 secondary antibody(Assay Biotech:SA0437)was diluted at 1:10000. 37 degree 1hour.)

WB (Western Blot)

(Western blot analysis of Hela. diluted at 1:1000)

product-image-AAA30800_WB4.png WB (Western Blot) (Western blot analysis of Hela. diluted at 1:1000)

WB (Western Blot)

(Western Blot analysis of chicken cell lysis using Antibody diluted at 1:1000)

product-image-AAA30800_WB3.png WB (Western Blot) (Western Blot analysis of chicken cell lysis using Antibody diluted at 1:1000)

Application Data

(The picture was kindly provided by our customer. Primary antibody was diluted at 1:2000. Loading control antibody was diluted at 1:5000)

product-image-AAA30800_APP2.png Application Data (The picture was kindly provided by our customer. Primary antibody was diluted at 1:2000. Loading control antibody was diluted at 1:5000)

Application Data

(The picture was kindly provided by our customer)

product-image-AAA30800_APP.png Application Data (The picture was kindly provided by our customer)
Related Product Information for anti-BCL-2 antibody
BCL2, apoptosis regulator(BCL2) Homo sapiens This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Product Categories/Family for anti-BCL-2 antibody

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
596
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
Molecular Weight
26,266 Da
NCBI Official Full Name
apoptosis regulator Bcl-2 alpha isoform
NCBI Official Synonym Full Names
B-cell CLL/lymphoma 2
NCBI Official Symbol
BCL2
NCBI Official Synonym Symbols
Bcl-2; PPP1R50
NCBI Protein Information
apoptosis regulator Bcl-2; protein phosphatase 1, regulatory subunit 50
UniProt Protein Name
Apoptosis regulator Bcl-2
UniProt Gene Name
BCL2
UniProt Entry Name
BCL2_HUMAN

Similar Products

Product Notes

The BCL-2 bcl2 (Catalog #AAA30800) is an Antibody produced from Mouse and is intended for research purposes only. The product is available for immediate purchase. The BCL-2 (PTR2303) Monoclonal Antibody reacts with Human, Mouse, Rat and may cross-react with other species as described in the data sheet. AAA Biotech's BCL-2 can be used in a range of immunoassay formats including, but not limited to, IF (Immunofluorescence), ICC (Immunocytochemistry), WB (Western Blot), IHC (Immunohistochemistry). WB: 1:500-2000 IF: 1:100-500 ELISA: 1:1000-5000. Researchers should empirically determine the suitability of the BCL-2 bcl2 for an application not listed in the data sheet. Researchers commonly develop new applications and it is an integral, important part of the investigative research process. It is sometimes possible for the material contained within the vial of "BCL-2, Monoclonal Antibody" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Submit a Question

Please complete the form below and a representative will contact you as soon as possible.

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.