IGHM cdna clone
IGHM cDNA Clone
Gene Names
IGHM; MU; VH; AGM1
Synonyms
IGHM; N/A; IGHM cDNA Clone; IGHM cdna clone
Sequence
atggagtttgggctgagctggctttttcttgtggctattttaaaaggtgtccagtgtgaggtgcagctgttggagtctgggggaggcttggtacagcctgggggatccctgagactctcctgtgcagcctctggattcagctttagcagctatgccatgaactgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagcggtggtagcacatattacgcagactccgtgaagggccggttcaccatctccagagacaattccagggacacgctctatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaagatccccggggttactctgcttcgggtaattatacccgggaggactactggggccagggaaccctggtcaccgtctcctcagggagtgcatccgccccaacccttttccccctcgtctcctgtgagaattccccgtcggatacgagcagcgtggccgttggctgcctcgcacaggacttccttcccgactccatcactttctcctggaaatacaagaacaactctgacatcagcagcacccggggcttcccatcagtcctgagagggggcaagtacgcagccacctcacaggtgctgctgccttccaaggacgtcatgcagggcacagacgaacacgtggtgtgcaaagtccagcaccccaacggcaacaaagaaaagaacgtgcctcttccagtgattgccgagctgcctcccaaagtgagcgtcttcgtcccaccccgcgacggcttcttcggcaacccccgcaagtccaagctcatctgccaggccacgggtttcagtccccggcagattcaggtgtcctggctgcgcgaggggaagcaggtggggtctggcgtcaccacggaccaggtgcaggctgaggccaaagagtctgggcccacgacctacaaggtgaccagcacactgaccatcaaagagagcgactggctcagccagagcatgttcacctgccgcgtggatcacaggggcctgaccttccagcagaatgcgtcctccatgtgtgtccccgatcaagacacagccatccgggtcttcgccatccccccatcctttgccagcatcttcctcaccaagtccaccaagttgacctgcctggtcacagacctgaccacctatgacagcgtgaccatctcctggacccgccagaatggcgaagctgtgaaaacccacaccaacatctccgagagccaccccaatgccactttcagcgccgtgggtgaggccagcatctgcgaggatgactggaattccggggagaggttcacgtgcaccgtgacccacacagacctgccctcgccactgaagcagaccatctcccggcccaagggggtggccctgcacaggcccgatgtctacttgctgccaccagcccgggagcagctgaacctgcgggagtcggccaccatcacgtgcctggtgacgggcttctctcccgcggacgtcttcgtgcagtggatgcagagggggcagcccttgtccccggagaagtatgtgaccagcgccccaatgcctgagccccaggccccaggccggtacttcgcccacagcatcctgaccgtgtccgaagaggaatggaacacgggggagacctacacctgcgtggtggcccatgaggccctgcccaacagggtcaccgagaggaccgtggacaagtccaccggtaaacccaccctgtacaacgtgtccctggtcatgtccgacacagctggcacctgctactga
Sequence Length
1794
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
NCBI Official Full Name
Homo sapiens immunoglobulin heavy constant mu, mRNA
NCBI Official Synonym Full Names
immunoglobulin heavy constant mu
NCBI Official Symbol
IGHM
NCBI Official Synonym Symbols
MU; VH; AGM1
UniProt Protein Name
Ig mu chain C region
UniProt Gene Name
IGHM
UniProt Entry Name
IGHM_HUMAN
Similar Products
Product Notes
The IGHM ighm (Catalog #AAA116456) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtttg ggctgagctg gctttttctt gtggctattt taaaaggtgt ccagtgtgag gtgcagctgt tggagtctgg gggaggcttg gtacagcctg ggggatccct gagactctcc tgtgcagcct ctggattcag ctttagcagc tatgccatga actgggtccg ccaggctcca gggaaggggc tggagtgggt ctcagctatt agtggtagcg gtggtagcac atattacgca gactccgtga agggccggtt caccatctcc agagacaatt ccagggacac gctctatctg caaatgaaca gcctgagagc cgaggacacg gccgtatatt actgtgcgaa agatccccgg ggttactctg cttcgggtaa ttatacccgg gaggactact ggggccaggg aaccctggtc accgtctcct cagggagtgc atccgcccca acccttttcc ccctcgtctc ctgtgagaat tccccgtcgg atacgagcag cgtggccgtt ggctgcctcg cacaggactt ccttcccgac tccatcactt tctcctggaa atacaagaac aactctgaca tcagcagcac ccggggcttc ccatcagtcc tgagaggggg caagtacgca gccacctcac aggtgctgct gccttccaag gacgtcatgc agggcacaga cgaacacgtg gtgtgcaaag tccagcaccc caacggcaac aaagaaaaga acgtgcctct tccagtgatt gccgagctgc ctcccaaagt gagcgtcttc gtcccacccc gcgacggctt cttcggcaac ccccgcaagt ccaagctcat ctgccaggcc acgggtttca gtccccggca gattcaggtg tcctggctgc gcgaggggaa gcaggtgggg tctggcgtca ccacggacca ggtgcaggct gaggccaaag agtctgggcc cacgacctac aaggtgacca gcacactgac catcaaagag agcgactggc tcagccagag catgttcacc tgccgcgtgg atcacagggg cctgaccttc cagcagaatg cgtcctccat gtgtgtcccc gatcaagaca cagccatccg ggtcttcgcc atccccccat cctttgccag catcttcctc accaagtcca ccaagttgac ctgcctggtc acagacctga ccacctatga cagcgtgacc atctcctgga cccgccagaa tggcgaagct gtgaaaaccc acaccaacat ctccgagagc caccccaatg ccactttcag cgccgtgggt gaggccagca tctgcgagga tgactggaat tccggggaga ggttcacgtg caccgtgacc cacacagacc tgccctcgcc actgaagcag accatctccc ggcccaaggg ggtggccctg cacaggcccg atgtctactt gctgccacca gcccgggagc agctgaacct gcgggagtcg gccaccatca cgtgcctggt gacgggcttc tctcccgcgg acgtcttcgt gcagtggatg cagagggggc agcccttgtc cccggagaag tatgtgacca gcgccccaat gcctgagccc caggccccag gccggtactt cgcccacagc atcctgaccg tgtccgaaga ggaatggaac acgggggaga cctacacctg cgtggtggcc catgaggccc tgcccaacag ggtcaccgag aggaccgtgg acaagtccac cggtaaaccc accctgtaca acgtgtccct ggtcatgtcc gacacagctg gcacctgcta ctga. It is sometimes possible for the material contained within the vial of "IGHM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.