HMGB1 cdna clone
HMGB1 cDNA Clone
Gene Names
HMGB1; HMG1; HMG3; SBP-1
Synonyms
HMGB1; N/A; HMGB1 cDNA Clone; HMGB1 cdna clone
Sequence
atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaggcggacaaggcccgttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttcaaggatcccaatgcacccaagaggcctccttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcagatgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtcaaggctgaaaaaagcaagaaaaagaaggaagaggaggaagatgaggaagatgaagaggatgaggaggaggaggaagatgaagaagatgaagatgaagaagaagatgatgatgatgaataa
Sequence Length
648
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Related Product Information for HMGB1 cdna clone
Homo sapiens high-mobility group box 1, mRNA (cDNA clone MGC:5223 IMAGE:2901382), complete cds.
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,894 Da
NCBI Official Full Name
Homo sapiens high-mobility group box 1, mRNA
NCBI Official Synonym Full Names
high mobility group box 1
NCBI Official Symbol
HMGB1
NCBI Official Synonym Symbols
HMG1; HMG3; SBP-1
NCBI Protein Information
high mobility group protein B1; HMG-1; Amphoterin; high-mobility group box 1; high mobility group protein 1; Sulfoglucuronyl carbohydrate binding protein; high-mobility group (nonhistone chromosomal) protein 1
UniProt Protein Name
High mobility group protein B1
UniProt Gene Name
HMGB1
UniProt Synonym Gene Names
HMG1; HMG-1
UniProt Entry Name
HMGB1_HUMAN
Customer Reviews
Loading reviews...
Share Your Experience
Similar Products
Product Notes
The HMGB1 hmgb1 (Catalog #AAA116369) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcaaag gagatcctaa gaagccgaga ggcaaaatgt catcatatgc attttttgtg caaacttgtc gggaggagca taagaagaag cacccagatg cttcagtcaa cttctcagag ttttctaaga agtgctcaga gaggtggaag accatgtctg ctaaagagaa aggaaaattt gaagatatgg caaaggcgga caaggcccgt tatgaaagag aaatgaaaac ctatatccct cccaaagggg agacaaaaaa gaagttcaag gatcccaatg cacccaagag gcctccttcg gccttcttcc tcttctgctc tgagtatcgc ccaaaaatca aaggagaaca tcctggcctg tccattggtg atgttgcgaa gaaactggga gagatgtgga ataacactgc tgcagatgac aagcagcctt atgaaaagaa ggctgcgaag ctgaaggaaa aatacgaaaa ggatattgct gcatatcgag ctaaaggaaa gcctgatgca gcaaaaaagg gagttgtcaa ggctgaaaaa agcaagaaaa agaaggaaga ggaggaagat gaggaagatg aagaggatga ggaggaggag gaagatgaag aagatgaaga tgaagaagaa gatgatgatg atgaataa. It is sometimes possible for the material contained within the vial of "HMGB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.